Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22073
Trapped Gene
Sfrs3 (ENSMUSG00000071172)
Vector Insertion
Chr 17: 29176433 - 29177719
Public Clones not available
Private Clones OST309440 (lexicon) OST203361 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700347 (Chr17:29176399..29176432 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700347 (Chr17:29176399..29176432 +)
Downstram Exon
ENSMUSE00000657875 (Chr17:29177720..29177758 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657877 Chr17:29169618..29169731 GTCGGAGCGTTAGGATTTGA Chr17:29169684..29169703 60.21 50
upstream ENSMUSE00000238003 Chr17:29173186..29173393 ATCGTGATTCCTGTCCCTTG Chr17:29173192..29173211 59.93 50
upstream ENSMUSE00000657876 Chr17:29175435..29175569 GATGATTACCGCAGGAGGAG Chr17:29175532..29175551 59.65 55
upstream ENSMUSE00000700347 Chr17:29176399..29176432 No primer for this exon

*** Putative Vector Insertion (Chr 17: 29176433 - 29177719) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657875 Chr17:29177720..29177758 No primer for this exon
downstream ENSMUSE00000657874 Chr17:29178152..29178238 GATCGAGACGGCTTGTGATT Chr17:29178223..29178242 60.23 50
downstream ENSMUSE00000609803 Chr17:29178329..29179039 TGCATCCCCATAGAGAAACC Chr17:29178874..29178893 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCCGTTACAGAGTCACCA Chr17:29176388..29176408 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCCGTTACAGAGTCACCA Chr17:29176388..29176408 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071172