Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2208
Trapped Gene
Arfip1 (ENSMUSG00000074513)
Vector Insertion
Chr 3: 84338618 - 84351855
Public Clones XR0403 (sanger) XR0819 (sanger) IST11041E6 (tigm)
Private Clones OST216044 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674130 (Chr3:84351856..84351957 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCAAGAATCTCCCAAAA Chr3:84351927..84351946 59.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674130 (Chr3:84351856..84351957 -)
Downstram Exon
ENSMUSE00000674129 (Chr3:84338509..84338617 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCAAGAATCTCCCAAAA Chr3:84351927..84351946 59.24 45 CCCCCTCTTTGGTACTGTCA Chr3:84338511..84338530 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674131 Chr3:84386336..84386547 GGAGGAGACGAAGGAAAAGC Chr3:84386444..84386463 60.33 55
upstream ENSMUSE00000674130 Chr3:84351856..84351957 GGCTCAAGAATCTCCCAAAA Chr3:84351927..84351946 59.24 45

*** Putative Vector Insertion (Chr 3: 84338618 - 84351855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674129 Chr3:84338509..84338617 CCCCCTCTTTGGTACTGTCA Chr3:84338511..84338530 59.96 55
downstream ENSMUSE00000674128 Chr3:84333092..84333187 TTACTAGCTGCCACCCTGCT Chr3:84333108..84333127 60.04 55
downstream ENSMUSE00000674127 Chr3:84331608..84331720 TGGTCCTCCTTTTGTGTGTG Chr3:84331667..84331686 59.56 50
downstream ENSMUSE00000638632 Chr3:84323404..84323625 GTGTGCACCATCTGGAAAAG Chr3:84323440..84323459 59.14 50
downstream ENSMUSE00000638630 Chr3:84319555..84319712 TAATGGCCCCAAGAAGAGTC Chr3:84319618..84319637 59.13 50
downstream ENSMUSE00000638629 Chr3:84313730..84313904 GCGGTACGCATCATATTCAA Chr3:84313861..84313880 59.55 45
downstream ENSMUSE00000638628 Chr3:84299985..84301813 GCACTGGATTTTCCGTCCTA Chr3:84300458..84300477 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTGTGTCTTAATCGCCTTG Chr3:84339793..84339814 59.62 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCATGGCTACAATAGGG Chr3:84339853..84339873 58.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr3:84339888..84339908 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGCATACACTTTCCCCAAA Chr3:84339920..84339940 58.62 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074513