Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2209
Trapped Gene
Ccrn4l (ENSMUSG00000023087)
Vector Insertion
Chr 3: 51029210 - 51051726
Public Clones (sanger) XR0381 (sanger) (sanger) YTC380 (baygenomics) CSH840 (baygenomics)
P095H02 (ggtc) D025C03 (ggtc) (ggtc) P095H02 (ggtc) P103G05 (ggtc)
E079C12 (ggtc) IST14582C6 (tigm) IST14631B5 (tigm)
Private Clones OST450768 (lexicon) OST443316 (lexicon) OST418723 (lexicon) OST299739 (lexicon)
OST281121 (lexicon) OST262725 (lexicon) OST224898 (lexicon) OST208284 (lexicon)
OST155223 (lexicon) OST143990 (lexicon) OST125086 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000432417 (Chr3:51028855..51029209 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGAGGAGGAAGGAACACC Chr3:51028922..51028941 61.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000432417 (Chr3:51028855..51029209 +)
Downstram Exon
ENSMUSE00000265885 (Chr3:51051727..51051996 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGAGGAGGAAGGAACACC Chr3:51028922..51028941 61.03 60 GGGGTCAGTTGACACCAAGT Chr3:51051836..51051855 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000432417 Chr3:51028855..51029209 GACGAGGAGGAAGGAACACC Chr3:51028922..51028941 61.03 60

*** Putative Vector Insertion (Chr 3: 51029210 - 51051726) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000265885 Chr3:51051727..51051996 GGGGTCAGTTGACACCAAGT Chr3:51051836..51051855 59.86 55
downstream ENSMUSE00000380782 Chr3:51053619..51055540 CCTTTTCAATGCGGGTTTTA Chr3:51054619..51054638 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAACCATAATCGCCTTGCAG Chr3:51038254..51038275 60.1 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAACCACGTGACTGGGAAA Chr3:51029253..51029274 60.38 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023087