Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22103
Trapped Gene
Rpp14 (ENSMUSG00000023156)
Vector Insertion
Chr 14: 8916309 - 8916430
Public Clones not available
Private Clones OST308459 (lexicon) OST62470 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306266 (Chr14:8916222..8916308 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGAGCCCCTCAGAGTATCA Chr14:8916270..8916290 59.44 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306266 (Chr14:8916222..8916308 +)
Downstram Exon
ENSMUSE00000306256 (Chr14:8916431..8916515 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGAGCCCCTCAGAGTATCA Chr14:8916270..8916290 59.44 52.38 GTTCAGTCCAACCCCATGTT Chr14:8916464..8916483 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000306272 Chr14:8912881..8913026 CAGTGATCCTCTCCGTCCTG Chr14:8912978..8912997 60.82 60
upstream ENSMUSE00000306266 Chr14:8916222..8916308 CAAGAGCCCCTCAGAGTATCA Chr14:8916270..8916290 59.44 52.38

*** Putative Vector Insertion (Chr 14: 8916309 - 8916430) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306256 Chr14:8916431..8916515 GTTCAGTCCAACCCCATGTT Chr14:8916464..8916483 59.68 50
downstream ENSMUSE00000133739 Chr14:8919978..8920054 ATGGCCGACAGTGTCTTCTC Chr14:8920039..8920058 60.27 55
downstream ENSMUSE00000133736 Chr14:8921233..8921311 AGGCTCCAAACAAGGTCAAA Chr14:8921279..8921298 59.71 45
downstream ENSMUSE00000394747 Chr14:8922422..8924350 AGCTTCCGGGACCATAACTT Chr14:8923059..8923078 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGATTTAATCGCCTTGCAG Chr14:8916354..8916374 58.91 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGATTCGTGACTGGGAAA Chr14:8916353..8916373 59.1 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023156