Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22107
Trapped Gene
Cdh22 (ENSMUSG00000053166)
Vector Insertion
Chr 2: 164960821 - 164967553
Public Clones not available
Private Clones OST308284 (lexicon) OST212140 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000422241 (Chr2:164967554..164967807 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCTAGGCACATTCCGAGA Chr2:164967710..164967729 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000422241 (Chr2:164967554..164967807 -)
Downstram Exon
ENSMUSE00000422237 (Chr2:164960684..164960820 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCTAGGCACATTCCGAGA Chr2:164967710..164967729 60.22 55 AAATCCGAGTCCCGATCAAT Chr2:164960772..164960791 60.66 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422264 Chr2:165060055..165060353 CCCTAGTCAGACACGCACAC Chr2:165060230..165060249 59.34 60
upstream ENSMUSE00000422258 Chr2:165006404..165006959 GAGGAGTACACGGGGACAGA Chr2:165006423..165006442 60.11 60
upstream ENSMUSE00000422253 Chr2:164996123..164996417 CGAGTCGGAGTTCATCATCA Chr2:164996204..164996223 59.79 50
upstream ENSMUSE00000422249 Chr2:164982750..164982869 GGCTGGTGTACAGTGTGCTG Chr2:164982787..164982806 60.38 60
upstream ENSMUSE00000422246 Chr2:164972105..164972272 GGAACGCTACGAGGTGGTTA Chr2:164972210..164972229 60.13 55
upstream ENSMUSE00000422243 Chr2:164969142..164969335 ACTCAGATGTGGGCGAGAAC Chr2:164969247..164969266 60.27 55
upstream ENSMUSE00000422241 Chr2:164967554..164967807 GACCTAGGCACATTCCGAGA Chr2:164967710..164967729 60.22 55

*** Putative Vector Insertion (Chr 2: 164960821 - 164967553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000422237 Chr2:164960684..164960820 AAATCCGAGTCCCGATCAAT Chr2:164960772..164960791 60.66 45
downstream ENSMUSE00000422235 Chr2:164949222..164949343 AGCTGCCTCGTAGGGTGTAG Chr2:164949227..164949246 59.52 60
downstream ENSMUSE00000422233 Chr2:164949016..164949133 TGAGGGTTGCTAGGTGCTTC Chr2:164949017..164949036 60.4 55
downstream ENSMUSE00000422231 Chr2:164941640..164941891 CACAGACCAAGAGAGCGATG Chr2:164941633..164941652 59.57 55
downstream ENSMUSE00000422255 Chr2:164937012..164938193 ATGTCATAGGCCTCGGTGTC Chr2:164938033..164938052 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGTGTGTTAATCGCCTTG Chr2:164967491..164967511 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGCACGTGACTGGGAAAA Chr2:164967488..164967508 63.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053166