Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22112
Trapped Gene
Timp1 (ENSMUSG00000001131)
Vector Insertion
Chr X: 20447451 - 20448159
Public Clones IST13631A5 (tigm)
Private Clones OST308143 (lexicon) OST308141 (lexicon) OST213529 (lexicon) OST181204 (lexicon)
OST126107 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707338 (ChrX:20447419..20447450 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707338 (ChrX:20447419..20447450 +)
Downstram Exon
ENSMUSE00000702520 (ChrX:20448160..20448288 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348871 ChrX:20447347..20447450 No primer for this exon
upstream ENSMUSE00000707338 ChrX:20447419..20447450 No primer for this exon

*** Putative Vector Insertion (Chr X: 20447451 - 20448159) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000368128 ChrX:20448157..20448288 No primer for this exon
downstream ENSMUSE00000702520 ChrX:20448160..20448288 No primer for this exon
downstream ENSMUSE00000205945 ChrX:20449903..20449982 No primer for this exon
downstream ENSMUSE00000205946 ChrX:20450176..20450302 No primer for this exon
downstream ENSMUSE00000205952 ChrX:20450494..20450618 No primer for this exon
downstream ENSMUSE00000391462 ChrX:20451597..20451861 No primer for this exon
downstream ENSMUSE00000702517 ChrX:20451597..20451858 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTCCTAGAGACACACCAGA ChrX:20447430..20447451 59.47 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTCCTAGAGACACACCAGA ChrX:20447430..20447451 59.47 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001131