Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22115
Trapped Gene
Faim (ENSMUSG00000032463)
Vector Insertion
Chr 9: 98886932 - 98892519
Public Clones not available
Private Clones OST308087 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000390647 (Chr9:98886792..98886931 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACTACGTCGTGGGATCG Chr9:98886886..98886905 61.67 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000390647 (Chr9:98886792..98886931 +)
Downstram Exon
ENSMUSE00000466797 (Chr9:98892520..98892652 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACTACGTCGTGGGATCG Chr9:98886886..98886905 61.67 60 AATGCTACGTCCCAAACAGC Chr9:98892579..98892598 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390647 Chr9:98886792..98886931 CTGACTACGTCGTGGGATCG Chr9:98886886..98886905 61.67 60

*** Putative Vector Insertion (Chr 9: 98886932 - 98892519) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000466797 Chr9:98892520..98892652 AATGCTACGTCCCAAACAGC Chr9:98892579..98892598 60.14 50
downstream ENSMUSE00000219854 Chr9:98892932..98893160 ACTCGTATGCGAAGCCACTT Chr9:98893052..98893071 59.9 50
downstream ENSMUSE00000219853 Chr9:98899386..98899435 TGACCATTGCACCATACGTC Chr9:98899422..98899441 60.4 50
downstream ENSMUSE00000229910 Chr9:98901974..98902437 TGGGATTTCCCTGTTATCCA Chr9:98902111..98902130 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr9:98889980..98890000 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGAACGTGACTGGGAAAAC Chr9:98889977..98889998 60.4 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032463