Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22126
Trapped Gene
Zfp345 (ENSMUSG00000074731)
Vector Insertion
Chr 2: 150300293 - 150300491
Public Clones not available
Private Clones OST307780 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640256 (Chr2:150300492..150300618 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCACGTGGGAAGAGTGG Chr2:150300568..150300587 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640256 (Chr2:150300492..150300618 -)
Downstram Exon
ENSMUSE00000640255 (Chr2:150300232..150300292 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCACGTGGGAAGAGTGG Chr2:150300568..150300587 60.15 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713796 Chr2:150310716..150310827 AAGGTTTCTCTGCGGTGTGT Chr2:150310777..150310796 59.77 50
upstream ENSMUSE00000640256 Chr2:150300492..150300618 ACTTCACGTGGGAAGAGTGG Chr2:150300568..150300587 60.15 55

*** Putative Vector Insertion (Chr 2: 150300293 - 150300491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640255 Chr2:150300232..150300292 No primer for this exon
downstream ENSMUSE00000640253 Chr2:150297666..150299160 GGCTTTGCCACAATGCTTAC Chr2:150297707..150297726 60.65 50
downstream ENSMUSE00000682087 Chr2:150296727..150299160 CATGAGGAAAGCCCCTATCA Chr2:150297222..150297241 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:150300420..150300440 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074731