Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22127
Trapped Gene
Ccdc76 (ENSMUSG00000033439)
Vector Insertion
Chr 3: 116295178 - 116295381
Public Clones not available
Private Clones OST307643 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000324552 (Chr3:116295382..116295428 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000324552 (Chr3:116295382..116295428 -)
Downstram Exon
ENSMUSE00000324543 (Chr3:116295111..116295177 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000443078 Chr3:116316677..116317505 GGTGGATATTCCGTTGATGG Chr3:116316880..116316899 60.01 50
upstream ENSMUSE00000401219 Chr3:116297557..116298511 AAAGGTTCTGTGGCGAACAC Chr3:116297572..116297591 60.16 50
upstream ENSMUSE00000324552 Chr3:116295382..116295428 No primer for this exon

*** Putative Vector Insertion (Chr 3: 116295178 - 116295381) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000324543 Chr3:116295111..116295177 No primer for this exon
downstream ENSMUSE00000324533 Chr3:116293148..116293210 TTGCTCAGGAATCTCTGTTTCA Chr3:116293129..116293150 59.99 40.91
downstream ENSMUSE00000324527 Chr3:116292652..116292721 No primer for this exon
downstream ENSMUSE00000324518 Chr3:116292409..116292515 TCATTAAGGGCATCATGCAA Chr3:116292430..116292449 60.03 40
downstream ENSMUSE00000324508 Chr3:116291390..116291557 TTCCTGCTCCAAACTCAACA Chr3:116291460..116291479 59.42 45
downstream ENSMUSE00000324497 Chr3:116288673..116288745 AAGCCTTTCAAACACTGAGTCC Chr3:116288679..116288700 59.79 45.46
downstream ENSMUSE00000324490 Chr3:116288114..116288188 CAGGTGCTTCCCAATTCCTA Chr3:116288108..116288127 60.07 50
downstream ENSMUSE00000324481 Chr3:116285412..116285841 CTCCATCATCGTGCTCTTCA Chr3:116285430..116285449 59.94 50
downstream ENSMUSE00000353072 Chr3:116284254..116284528 TGATGTTTTTCCTGCGATGA Chr3:116284315..116284334 60.2 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTGGGGTGCGTGAGTAAT Chr3:116295326..116295346 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGGGTTTTTGTCATTTGG Chr3:116295340..116295361 58.85 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033439