Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22129
Trapped Gene
Mrpl23 (ENSMUSG00000037772)
Vector Insertion
Chr 7: 149721033 - 149721974
Public Clones not available
Private Clones OST307495 (lexicon) OST211120 (lexicon) OST204565 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225458 (Chr7:149720910..149721032 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTGAAGATACCGTGCAGT Chr7:149720997..149721016 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225458 (Chr7:149720910..149721032 +)
Downstram Exon
ENSMUSE00000225445 (Chr7:149721975..149722057 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTGAAGATACCGTGCAGT Chr7:149720997..149721016 60.28 55 AGCCACGGGAACATTGTAAA Chr7:149722035..149722054 60.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225470 Chr7:149719080..149719099 No primer for this exon
upstream ENSMUSE00000225458 Chr7:149720910..149721032 GCCTGAAGATACCGTGCAGT Chr7:149720997..149721016 60.28 55

*** Putative Vector Insertion (Chr 7: 149721033 - 149721974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225445 Chr7:149721975..149722057 AGCCACGGGAACATTGTAAA Chr7:149722035..149722054 60.37 45
downstream ENSMUSE00000225432 Chr7:149723172..149723245 TGCACGTAGGCCACTTTGTA Chr7:149723244..149723263 60.32 50
downstream ENSMUSE00000385249 Chr7:149726424..149726648 GTCATAGGCCAAACCAGGAA Chr7:149726571..149726590 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCCATGGAGTAAGTGAGG Chr7:149721024..149721044 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTGAAGATACCGTGCAGT Chr7:149720998..149721018 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037772