Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22131
Trapped Gene
Rab13 (ENSMUSG00000027935)
Vector Insertion
Chr 3: 90027510 - 90027711
Public Clones not available
Private Clones OST307475 (lexicon) OST280925 (lexicon) OST51353 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672919 (Chr3:90027449..90027509 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCGCCTATTACCGTGGAG Chr3:90027485..90027504 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672919 (Chr3:90027449..90027509 +)
Downstram Exon
ENSMUSE00000174454 (Chr3:90027712..90027789 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCGCCTATTACCGTGGAG Chr3:90027485..90027504 59.97 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672921 Chr3:90017617..90017744 AAGGTCCGTAAAGGCTCCTC Chr3:90017703..90017722 59.71 55
upstream ENSMUSE00000566764 Chr3:90024739..90024944 TGTCTGATCATTCGCTTTGC Chr3:90024887..90024906 59.96 45
upstream ENSMUSE00000305414 Chr3:90026159..90026219 ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50
upstream ENSMUSE00000672920 Chr3:90026159..90026219 ATCCGAACCGTGGACATAGA Chr3:90026173..90026192 60.34 50
upstream ENSMUSE00000174453 Chr3:90027449..90027509 TACCGCCTATTACCGTGGAG Chr3:90027485..90027504 59.97 55
upstream ENSMUSE00000672919 Chr3:90027449..90027509 TACCGCCTATTACCGTGGAG Chr3:90027485..90027504 59.97 55

*** Putative Vector Insertion (Chr 3: 90027510 - 90027711) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174454 Chr3:90027712..90027789 No primer for this exon
downstream ENSMUSE00000174448 Chr3:90028416..90028505 GTCACACTTGTTTCCCAGCA Chr3:90028466..90028485 59.73 50
downstream ENSMUSE00000174450 Chr3:90028624..90028689 ACTGGATTTGGCACTCGTCT Chr3:90028677..90028696 59.73 50
downstream ENSMUSE00000174451 Chr3:90028770..90028823 No primer for this exon
downstream ENSMUSE00000456693 Chr3:90029431..90029885 GCTTGAGGGCTTACTGTTGG Chr3:90029457..90029476 59.88 55
downstream ENSMUSE00000672918 Chr3:90029431..90030307 ACAGGATGTCCGTCCTTCAG Chr3:90030068..90030087 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCGCCTATTACCGTGGAG Chr3:90027486..90027506 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCGCCTATTACCGTGGAG Chr3:90027486..90027506 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027935