Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22139
Trapped Gene
A930012O16Rik (ENSMUSG00000054181)
Vector Insertion
Chr 2: 57089384 - 57090124
Public Clones IST12559F11 (tigm) IST12559F11BBF1 (tigm)
Private Clones OST307198 (lexicon) OST281449 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435288 (Chr2:57090125..57090919 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATACCCCAGCGTGTTCT Chr2:57090249..57090268 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435288 (Chr2:57090125..57090919 -)
Downstram Exon
ENSMUSE00000435279 (Chr2:57088778..57089383 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATACCCCAGCGTGTTCT Chr2:57090249..57090268 60.13 55 GGCTTCCGATTTTTCTCCTC Chr2:57089020..57089039 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435288 Chr2:57090125..57090919 CAGATACCCCAGCGTGTTCT Chr2:57090249..57090268 60.13 55

*** Putative Vector Insertion (Chr 2: 57089384 - 57090124) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435279 Chr2:57088778..57089383 GGCTTCCGATTTTTCTCCTC Chr2:57089020..57089039 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000054181