Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22141
Trapped Gene
Rad51ap1 (ENSMUSG00000030346)
Vector Insertion
Chr 6: 126886027 - 126889511
Public Clones IST13215D5 (tigm) IST14209C5 (tigm)
Private Clones OST307156 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690836 (Chr6:126889512..126889573 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690836 (Chr6:126889512..126889573 -)
Downstram Exon
ENSMUSE00000408291 (Chr6:126885971..126886026 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGCCAGAATCTTCAAACTGTG Chr6:126885960..126885981 60.28 40.91

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690820 Chr6:126889512..126889605 No primer for this exon
upstream ENSMUSE00000690836 Chr6:126889512..126889573 No primer for this exon

*** Putative Vector Insertion (Chr 6: 126886027 - 126889511) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000408291 Chr6:126885971..126886026 TTGCCAGAATCTTCAAACTGTG Chr6:126885960..126885981 60.28 40.91
downstream ENSMUSE00000197676 Chr6:126884732..126884867 TTTTTAGGGGGTTCTGTTGG Chr6:126884713..126884732 58.92 45
downstream ENSMUSE00000690829 Chr6:126884732..126884873 TTTTAGGGGGTTCTGTTGGT Chr6:126884714..126884733 58.41 45
downstream ENSMUSE00000197678 Chr6:126880011..126880120 TGGTTGGTGAGTGTTGGAAG Chr6:126880012..126880031 59.56 50
downstream ENSMUSE00000197675 Chr6:126878159..126878245 TTTGCCTTGTTTGTCAGTGC Chr6:126878204..126878223 59.89 45
downstream ENSMUSE00000197672 Chr6:126877556..126877708 GGCTTGAGATGGTGACTTCC Chr6:126877613..126877632 59.66 55
downstream ENSMUSE00000690810 Chr6:126877556..126877705 GGCTTGAGATGGTGACTTCC Chr6:126877613..126877632 59.66 55
downstream ENSMUSE00000197674 Chr6:126876377..126876535 CTTTTCCCCTGCAGGTTTCT Chr6:126876392..126876411 60.6 50
downstream ENSMUSE00000197677 Chr6:126874936..126875085 CTGGTTTCCTAGTGGCCTCA Chr6:126874968..126874987 60.25 55
downstream ENSMUSE00000651290 Chr6:126873437..126874358 CCCGAGTGACAGTGGCTTAT Chr6:126873967..126873986 60.13 55
downstream ENSMUSE00000690816 Chr6:126873068..126874358 CCCGAGTGACAGTGGCTTAT Chr6:126873967..126873986 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCGTCCTATCAGGTGAG Chr6:126889505..126889525 60.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGGTGAGTGGTTGGTGAC Chr6:126889494..126889514 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGAAATTAATCGCCTTGCAG Chr6:126889509..126889530 60.21 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAATCGTGACTGGGAAAACC Chr6:126889507..126889527 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030346