Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22147
Trapped Gene
Efhb (ENSMUSG00000023931)
Vector Insertion
Chr 17: 53585181 - 53588709
Public Clones not available
Private Clones OST306674 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136452 (Chr17:53588710..53588890 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCCCATTACCACGTTTC Chr17:53588851..53588870 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136452 (Chr17:53588710..53588890 -)
Downstram Exon
ENSMUSE00000136447 (Chr17:53585070..53585180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCCCATTACCACGTTTC Chr17:53588851..53588870 59.86 50 TTCGAAGGATTTCGATGGAT Chr17:53585115..53585134 59.46 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000370133 Chr17:53601756..53602646 CACCTGTGTCGTGATGAACC Chr17:53601998..53602017 60.01 55
upstream ENSMUSE00000136456 Chr17:53591886..53591948 TGCAACCTGTTTGACTGAGAA Chr17:53591896..53591916 59.47 42.86
upstream ENSMUSE00000136458 Chr17:53590876..53591019 ACCCCCAAATTGCACCTTAT Chr17:53590912..53590931 60.43 45
upstream ENSMUSE00000136452 Chr17:53588710..53588890 ACAGCCCATTACCACGTTTC Chr17:53588851..53588870 59.86 50

*** Putative Vector Insertion (Chr 17: 53585181 - 53588709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136447 Chr17:53585070..53585180 TTCGAAGGATTTCGATGGAT Chr17:53585115..53585134 59.46 40
downstream ENSMUSE00000136449 Chr17:53576409..53576538 TGCCGGGTTATATTTTCGAT Chr17:53576485..53576504 59.28 40
downstream ENSMUSE00000136445 Chr17:53566235..53566318 No primer for this exon
downstream ENSMUSE00000136457 Chr17:53565537..53565604 GACCTGGGGGAACATTCATA Chr17:53565551..53565570 59.6 50
downstream ENSMUSE00000136455 Chr17:53561200..53561354 GAAAGCCACCTGCAAAGTGT Chr17:53561193..53561212 60.3 50
downstream ENSMUSE00000136454 Chr17:53552788..53552995 TCCTGGTCCACGTCACAGTA Chr17:53552858..53552877 60.15 55
downstream ENSMUSE00000136459 Chr17:53540760..53540972 CCACAGCGTTGATCTCAGAA Chr17:53540759..53540778 59.98 50
downstream ENSMUSE00000321516 Chr17:53540071..53540252 TGTCAGATCGAATGGTTGGA Chr17:53540192..53540211 60.05 45
downstream ENSMUSE00000395326 Chr17:53538214..53538444 CATGGCCGTTTTACACTTGA Chr17:53538252..53538271 59.58 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGATGGATAATCGCCTTG Chr17:53588647..53588667 60.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAACTCGTGACTGGGAAA Chr17:53588645..53588665 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023931