Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2215
Trapped Gene
Lmnb2 (ENSMUSG00000062075)
Vector Insertion
Chr 10: 80372791 - 80380708
Public Clones XP0272 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436317 (Chr10:80380709..80380990 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATCTCCGAGAAGGAGGAG Chr10:80380724..80380743 60.29 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436317 (Chr10:80380709..80380990 -)
Downstram Exon
ENSMUSE00000609520 (Chr10:80372654..80372790 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATCTCCGAGAAGGAGGAG Chr10:80380724..80380743 60.29 60 AGGGTCTTGATGCCACTCAC Chr10:80372749..80372768 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436317 Chr10:80380709..80380990 GGATCTCCGAGAAGGAGGAG Chr10:80380724..80380743 60.29 60

*** Putative Vector Insertion (Chr 10: 80372791 - 80380708) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609520 Chr10:80372654..80372790 AGGGTCTTGATGCCACTCAC Chr10:80372749..80372768 60.12 55
downstream ENSMUSE00000436296 Chr10:80370130..80370286 CCTCACTCCGGTGAAACAGT Chr10:80370185..80370204 60.15 55
downstream ENSMUSE00000410365 Chr10:80369896..80370021 ATCAGCGTCTCCTTCTCCAA Chr10:80369947..80369966 59.95 50
downstream ENSMUSE00000665847 Chr10:80368749..80369000 CTCGGACGTCGTTTCACATA Chr10:80368830..80368849 59.72 50
downstream ENSMUSE00000436282 Chr10:80367826..80367996 GCCTGAGCCATCTTGAAGTC Chr10:80367883..80367902 59.96 55
downstream ENSMUSE00000436031 Chr10:80367631..80367756 GGCCTAAAAGCTGGTAGCTG Chr10:80367620..80367639 59.13 55
downstream ENSMUSE00000288932 Chr10:80367298..80367518 TTCCTTAGCGTCCAGCATCT Chr10:80367407..80367426 59.98 50
downstream ENSMUSE00000436015 Chr10:80366860..80367133 AGAGTTCTTAAGGCGCACGA Chr10:80366847..80366866 60.15 50
downstream ENSMUSE00000507292 Chr10:80366676..80366783 CTCCAGTTCCCCAAAGACTG Chr10:80366739..80366758 59.69 55
downstream ENSMUSE00000609519 Chr10:80366195..80366314 TTTCCACACAAGGGTTGATG Chr10:80366236..80366255 59.39 45
downstream ENSMUSE00000574690 Chr10:80365957..80366067 TTCACCGAATTCTGCCTCTT Chr10:80365956..80365975 59.81 45
downstream ENSMUSE00000609518 Chr10:80364109..80365645 GCACTAAGTTGCAGGGAAGC Chr10:80364778..80364797 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGAGGAGGTGACCACTCG Chr10:80380711..80380731 61.63 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAAGGAGGAGGTGACCACT Chr10:80380713..80380734 59.72 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062075