Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22153
Trapped Gene
Ankrd35 (ENSMUSG00000038354)
Vector Insertion
Chr 3: 96474373 - 96482055
Public Clones (sanger) (ggtc) CMHD-GT_518F12-5S (cmhd) IST15078D12 (tigm) IST13072E8 (tigm)
IST10807E2 (tigm) IST13239H6 (tigm) IST10605D4 (tigm) IST12590A9BBF1 (tigm)
IST13662H3 (tigm) IST10012B9 (tigm) IST12788H9 (tigm) IST10788H12 (tigm)
IST10034H11 (tigm) IST14408H8 (tigm) IST11055D3 (tigm) IST14966F2 (tigm)
IST10980E4 (tigm) IST13819G4 (tigm) IST14556E2 (tigm) IST10880E6 (tigm)
IST14987F5 (tigm) IST10731A6 (tigm) IST14949F11 (tigm) IST11168D2 (tigm)
IST12788H9 (tigm) IST15057G8 (tigm) IST13033C9 (tigm) IST14628A7 (tigm)
IST10750B6 (tigm) IST15057G7 (tigm) IST12968A3 (tigm) IST14798C5 (tigm)
IST14548E11 (tigm) IST10437G2 (tigm) IST10832E3 (tigm) IST13989C2 (tigm)
IST10411C7 (tigm) IST11019D10 (tigm) IST14832D7 (tigm) IST11986E4 (tigm)
IST13497F10 (tigm) IST13033C9 (tigm) IST12590A9 (tigm) IST14893E8 (tigm)
IST11833H6 (tigm) IST14570C1 (tigm) IST14375A1 (tigm) IST15016F2 (tigm)
IST10260G9 (tigm) IST15078D12 (tigm) IST10411C7 (tigm) IST11089A10 (tigm)
IST14933F1 (tigm) IST12257C7 (tigm) IST13064B11 (tigm) IST13209B2 (tigm)
IST10587G6 (tigm) IST14354E12 (tigm) IST13403E11 (tigm) IST11050G10 (tigm)
IST13819G4 (tigm) IST10088B7 (tigm) IST12257C7 (tigm) IST12472A12 (tigm)
IST12244D12 (tigm) IST10366C5 (tigm) IST15068C12 (tigm) IST14404E4 (tigm)
IST14220G1 (tigm) IST14795B12 (tigm) IST13984F3 (tigm) IST10807E2 (tigm)
IST10467C8 (tigm) IST10437G2 (tigm) IST13705D9 (tigm) IST14215C11 (tigm)
IST13403E11 (tigm) IST10383A5 (tigm) IST10326A8 (tigm) IST12244D12 (tigm)
IST10004H2 (tigm) IST10525A2 (tigm) IST14369G9 (tigm) IST10260G9 (tigm)
IST13300B4 (tigm) IST12428F7 (tigm) IST14511F3 (tigm)
Private Clones OST306483 (lexicon) OST187118 (lexicon) OST166760 (lexicon) OST166117 (lexicon)
OST128026 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410288 (Chr3:96474054..96474372 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410288 (Chr3:96474054..96474372 +)
Downstram Exon
ENSMUSE00000370295 (Chr3:96482056..96482186 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50 GATCACGTCGGTTCCATTTC Chr3:96482083..96482102 60.33 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410288 Chr3:96474054..96474372 TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50

*** Putative Vector Insertion (Chr 3: 96474373 - 96482055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370295 Chr3:96482056..96482186 GATCACGTCGGTTCCATTTC Chr3:96482083..96482102 60.33 50
downstream ENSMUSE00000397790 Chr3:96483103..96483191 CCCCATTTGCAAGCAGTATT Chr3:96483167..96483186 59.96 45
downstream ENSMUSE00000357628 Chr3:96483553..96483617 ACACACTGTGGCTGACAGGA Chr3:96483604..96483623 60.37 55
downstream ENSMUSE00000346384 Chr3:96484394..96484451 AATGGACTGCGATTTTCTGC Chr3:96484443..96484462 60.22 45
downstream ENSMUSE00000384381 Chr3:96484550..96484620 CACAGCAGGAGGACACTTGA Chr3:96484589..96484608 60.02 55
downstream ENSMUSE00000334317 Chr3:96484885..96484991 CATTAACTCGGGCACCTCTC Chr3:96484975..96484994 59.69 55
downstream ENSMUSE00000369013 Chr3:96485950..96486134 AAGAGCGTTGTGTCCCAAAC Chr3:96486061..96486080 60.16 50
downstream ENSMUSE00000362130 Chr3:96486917..96486954 GAGATGGGTGATCTGGGTGT Chr3:96486955..96486974 59.77 55
downstream ENSMUSE00000354995 Chr3:96487106..96489097 CCGATGAGGTGGTTTGTCTT Chr3:96489075..96489094 59.97 50
downstream ENSMUSE00000248243 Chr3:96493069..96493158 GCTCGAGCTTCTTCAGCAAC Chr3:96493099..96493118 60.43 55
downstream ENSMUSE00000248237 Chr3:96493368..96493433 TTCGTGGTTCTTCTGGGAGT Chr3:96493391..96493410 59.7 50
downstream ENSMUSE00000438379 Chr3:96494115..96494957 TCAGGTCTGGAGTTCGTGTG Chr3:96494872..96494891 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTCACAAGTGGCGGTAGG Chr3:96474359..96474379 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTCACAAGTGGCGGTAGG Chr3:96474359..96474379 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038354