Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22159
Trapped Gene
Btf3l4 (ENSMUSG00000028568)
Vector Insertion
Chr 4: 108490850 - 108491740
Public Clones not available
Private Clones OST305649 (lexicon) OST301996 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662464 (Chr4:108491741..108491942 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTCCGCTAACACCTTTGC Chr4:108491860..108491879 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662464 (Chr4:108491741..108491942 -)
Downstram Exon
ENSMUSE00000662463 (Chr4:108490790..108490849 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTCCGCTAACACCTTTGC Chr4:108491860..108491879 60.01 55 CTGGTTTGGGCGCTTTACTA Chr4:108490801..108490820 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662460 Chr4:108506113..108506159 No primer for this exon
upstream ENSMUSE00000662466 Chr4:108506113..108506219 GAGGCAGCCATCTTGCTCTT Chr4:108506150..108506169 61.97 55
upstream ENSMUSE00000662461 Chr4:108505748..108506169 CAGTGTCAGACGCTTTGAGC Chr4:108505789..108505808 59.78 55
upstream ENSMUSE00000662459 Chr4:108505018..108505056 No primer for this exon
upstream ENSMUSE00000662457 Chr4:108504311..108504536 TGCTGCACAGCTAAGATTGG Chr4:108504469..108504488 60.16 50
upstream ENSMUSE00000662465 Chr4:108503123..108503188 TCAAGCTCAGGTCCGGATAG Chr4:108503131..108503150 60.35 55
upstream ENSMUSE00000716151 Chr4:108503123..108503188 TCAAGCTCAGGTCCGGATAG Chr4:108503131..108503150 60.35 55
upstream ENSMUSE00000525636 Chr4:108498705..108498818 ACAGCTCGCAGGAAGAAGAA Chr4:108498796..108498815 60.28 50
upstream ENSMUSE00000662464 Chr4:108491741..108491942 CTCTCCGCTAACACCTTTGC Chr4:108491860..108491879 60.01 55

*** Putative Vector Insertion (Chr 4: 108490850 - 108491740) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662463 Chr4:108490790..108490849 CTGGTTTGGGCGCTTTACTA Chr4:108490801..108490820 60.26 50
downstream ENSMUSE00000662456 Chr4:108489437..108489491 GCTTCATTTTTCGATGCTTCA Chr4:108489430..108489450 60.34 38.1
downstream ENSMUSE00000662458 Chr4:108489396..108489491 TCTAGTCCATGCCAGCTTCC Chr4:108489388..108489407 60.36 55
downstream ENSMUSE00000601484 Chr4:108489323..108489491 TCTAGTCCATGCCAGCTTCC Chr4:108489388..108489407 60.36 55
downstream ENSMUSE00000662462 Chr4:108489055..108489491 CAAATGACCGAGAACTGCTG Chr4:108489264..108489283 59.44 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTGCTGTCACTAAGACG Chr4:108491687..108491707 59.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028568