Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22171
Trapped Gene
5730596K20Rik (ENSMUSG00000024759)
Vector Insertion
Chr 19: 7584053 - 7584472
Public Clones not available
Private Clones OST305110 (lexicon) OST213455 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144777 (Chr19:7583838..7584052 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCAGTGCAGGTTGTTTT Chr19:7583864..7583883 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144777 (Chr19:7583838..7584052 +)
Downstram Exon
ENSMUSE00000238419 (Chr19:7584473..7584616 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCAGTGCAGGTTGTTTT Chr19:7583864..7583883 60.01 50 TTCCACATGGCTTCTTCACA Chr19:7584614..7584633 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643443 Chr19:7568971..7569151 AACCCGCTCCTGTCTTCTCT Chr19:7569053..7569072 60.39 55
upstream ENSMUSE00000144777 Chr19:7583838..7584052 GGTCCAGTGCAGGTTGTTTT Chr19:7583864..7583883 60.01 50

*** Putative Vector Insertion (Chr 19: 7584053 - 7584472) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238419 Chr19:7584473..7584616 TTCCACATGGCTTCTTCACA Chr19:7584614..7584633 60.24 45
downstream ENSMUSE00000550582 Chr19:7591368..7591472 CCTGGGTATCCATCAGAACAA Chr19:7591397..7591417 59.8 47.62
downstream ENSMUSE00000144779 Chr19:7593036..7593086 No primer for this exon
downstream ENSMUSE00000144785 Chr19:7595277..7595333 GCGGCCATATTCTGTGAAGA Chr19:7595300..7595319 61.14 50
downstream ENSMUSE00000144784 Chr19:7595600..7595692 AAGGGAAACTCCAATCTCGAA Chr19:7595638..7595658 60.06 42.86
downstream ENSMUSE00000144788 Chr19:7596559..7596697 CAGGTGACATCGGAGAAACA Chr19:7596635..7596654 59.68 50
downstream ENSMUSE00000144783 Chr19:7603432..7603559 GGCAGGTGACTTTTGAACCA Chr19:7603539..7603558 61.08 50
downstream ENSMUSE00000144787 Chr19:7604098..7604154 GGTGAGGCAGATCTTCTCCTT Chr19:7604139..7604159 59.83 52.38
downstream ENSMUSE00000144780 Chr19:7605010..7605081 CCAAATTATTGGCTTCAGCA Chr19:7605037..7605056 58.77 40
downstream ENSMUSE00000144781 Chr19:7606506..7606937 ACTGCCCGGAATATCTGATG Chr19:7606887..7606906 59.92 50
downstream ENSMUSE00000643432 Chr19:7608440..7611090 CAACAACGGCATCCCTTACT Chr19:7608497..7608516 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAAGGTCCGTGACTGGGAAA Chr19:7584096..7584117 60.73 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024759