Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22174
Trapped Gene
Eras (ENSMUSG00000031160)
Vector Insertion
Chr X: 7502340 - 7505594
Public Clones (sanger) (sanger) (sanger) IST14270C9 (tigm) IST11918F8 (tigm)
IST11527H5 (tigm) IST10451D8 (tigm)
Private Clones OST305023 (lexicon) OST299884 (lexicon) OST281686 (lexicon) OST270145 (lexicon)
OST218885 (lexicon) OST213681 (lexicon) OST43467 (lexicon) OST32501 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426554 (ChrX:7505595..7505626 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426554 (ChrX:7505595..7505626 -)
Downstram Exon
ENSMUSE00000206954 (ChrX:7501402..7502339 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAAGCCTCGTGACTTTCCTC ChrX:7502194..7502213 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426554 ChrX:7505595..7505626 No primer for this exon

*** Putative Vector Insertion (Chr X: 7502340 - 7505594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206954 ChrX:7501402..7502339 CAAGCCTCGTGACTTTCCTC ChrX:7502194..7502213 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTGGGAGCACAGGTAAG ChrX:7505588..7505608 59.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTGGGAGCACAGGTAAG ChrX:7505588..7505608 59.86 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTCCTGGGAGCACAGGTAA ChrX:7505589..7505609 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTCCTGGGAGCACAGGTAA ChrX:7505589..7505609 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031160