Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22195
Trapped Gene
D1Ertd622e (ENSMUSG00000044768)
Vector Insertion
Chr 1: 99540479 - 99542939
Public Clones not available
Private Clones OST303637 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688610 (Chr1:99540486..99542938 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGACACGGAAGTGCTACA Chr1:99542353..99542372 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688610 (Chr1:99540486..99542938 -)
Downstram Exon
ENSMUSE00000414694 (Chr1:99540480..99542938 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGACACGGAAGTGCTACA Chr1:99542353..99542372 60.06 55 TTTGGTGCACTTGTCTCCTG Chr1:99542477..99542496 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401666 Chr1:99558408..99558542 No primer for this exon
upstream ENSMUSE00000706939 Chr1:99558408..99558651 No primer for this exon
upstream ENSMUSE00000358233 Chr1:99551177..99551266 CCTTGGGACACTTTGGAACT Chr1:99551208..99551227 59.04 50
upstream ENSMUSE00000688610 Chr1:99540486..99542938 GCTGACACGGAAGTGCTACA Chr1:99542353..99542372 60.06 55
upstream ENSMUSE00000414694 Chr1:99540480..99542938 GCTGACACGGAAGTGCTACA Chr1:99542353..99542372 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTTCCTTTCAGGCGTGT Chr1:99542931..99542951 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTTCCTTTCAGGCGTGT Chr1:99542931..99542951 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044768