Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22202
Trapped Gene
Sap30l (ENSMUSG00000020519)
Vector Insertion
Chr 11: 57621625 - 57623443
Public Clones not available
Private Clones OST303578 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105598 (Chr11:57621526..57621624 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105598 (Chr11:57621526..57621624 +)
Downstram Exon
ENSMUSE00000335155 (Chr11:57623444..57623716 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362685 Chr11:57615139..57615791 No primer for this exon
upstream ENSMUSE00000105597 Chr11:57619546..57619668 No primer for this exon
upstream ENSMUSE00000105598 Chr11:57621526..57621624 No primer for this exon

*** Putative Vector Insertion (Chr 11: 57621625 - 57623443) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335155 Chr11:57623444..57623716 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACCAGACCAGGCTTCAAC Chr11:57621588..57621608 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCAGACCAGGCTTCAAC Chr11:57621588..57621608 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020519