Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22229
Trapped Gene
Epb4.9 (ENSMUSG00000022099)
Vector Insertion
Chr 14: 71017837 - 71018045
Public Clones not available
Private Clones OST302881 (lexicon) OST276765 (lexicon) OST232698 (lexicon) OST191772 (lexicon)
OST189077 (lexicon) OST170688 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488293 (Chr14:71018046..71018215 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCTGACGTCTGTCCTCT Chr14:71018112..71018131 59.58 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488293 (Chr14:71018046..71018215 -)
Downstram Exon
ENSMUSE00000260068 (Chr14:71017762..71017836 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCTGACGTCTGTCCTCT Chr14:71018112..71018131 59.58 60 GGAGTCTCTGGAGGAGCTGA Chr14:71017770..71017789 59.66 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486499 Chr14:71029824..71029961 TGCTGGGATTGCTAATGTGA Chr14:71029851..71029870 60.22 45
upstream ENSMUSE00000487384 Chr14:71026546..71026675 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55
upstream ENSMUSE00000686201 Chr14:71026546..71026865 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55
upstream ENSMUSE00000488293 Chr14:71018046..71018215 GAGCCTGACGTCTGTCCTCT Chr14:71018112..71018131 59.58 60

*** Putative Vector Insertion (Chr 14: 71017837 - 71018045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260068 Chr14:71017762..71017836 GGAGTCTCTGGAGGAGCTGA Chr14:71017770..71017789 59.66 60
downstream ENSMUSE00000123586 Chr14:71017092..71017247 GAGGTCAGGTCGCTCAATGT Chr14:71017136..71017155 60.27 55
downstream ENSMUSE00000123581 Chr14:71015881..71015925 GATTTGGGTGACAGTGAGCA Chr14:71015884..71015903 59.68 50
downstream ENSMUSE00000123588 Chr14:71015421..71015520 GGGGTTGAAGCCTGAGAGAT Chr14:71015449..71015468 60.6 55
downstream ENSMUSE00000123583 Chr14:71015041..71015097 TTGTAGATGGGTGGCTTCTTG Chr14:71015027..71015047 60.12 47.62
downstream ENSMUSE00000260042 Chr14:71014650..71014802 ATGAGGTCCTCGATGAGGTG Chr14:71014732..71014751 60.07 55
downstream ENSMUSE00000260038 Chr14:71013103..71013227 CTTCCGTTTCCTCCATTCTG Chr14:71013183..71013202 59.67 50
downstream ENSMUSE00000123580 Chr14:71012475..71012580 GCAGAGAGCGTGTTTTCCTC Chr14:71012477..71012496 60.14 55
downstream ENSMUSE00000260028 Chr14:71005701..71005765 CCATAGGAAGGAAGCGAAGA Chr14:71005698..71005717 59.41 50
downstream ENSMUSE00000555961 Chr14:71005500..71005548 ATGGGCTGAATTCTGTGGAC Chr14:71005502..71005521 59.93 50
downstream ENSMUSE00000647515 Chr14:71005348..71005355 No primer for this exon
downstream ENSMUSE00000555954 Chr14:71005104..71005169 No primer for this exon
downstream ENSMUSE00000123585 Chr14:71004775..71004855 CCCTTATTGGTCACCACCAG Chr14:71004796..71004815 60.22 55
downstream ENSMUSE00000555964 Chr14:71003480..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50
downstream ENSMUSE00000647502 Chr14:71001070..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGTCTGCAGAAGGTGAGC Chr14:71018038..71018058 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGTCTGCAGAAGGTGAGC Chr14:71018038..71018058 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022099