Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22235
Trapped Gene
Fut11 (ENSMUSG00000039357)
Vector Insertion
Chr 14: 21515636 - 21517432
Public Clones (sanger) IST14727C10 (tigm) IST15000A10 (tigm) IST15000A10 (tigm)
IST10612D1 (tigm) IST14772H12 (tigm) IST10287A12 (tigm) IST10612D1 (tigm)
IST10287A12 (tigm)
Private Clones OST302765 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234137 (Chr14:21515010..21515635 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCATCACCAACCAGTTTCT Chr14:21515373..21515392 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234137 (Chr14:21515010..21515635 +)
Downstram Exon
ENSMUSE00000234130 (Chr14:21517433..21519419 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCATCACCAACCAGTTTCT Chr14:21515373..21515392 59.97 50 GCTTCCCCCTGATAGAGACC Chr14:21517489..21517508 60.04 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234144 Chr14:21514190..21514920 TCTTTTACGGCACGGACTTC Chr14:21514574..21514593 60.25 50
upstream ENSMUSE00000234137 Chr14:21515010..21515635 GGCATCACCAACCAGTTTCT Chr14:21515373..21515392 59.97 50

*** Putative Vector Insertion (Chr 14: 21515636 - 21517432) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234130 Chr14:21517433..21519419 GCTTCCCCCTGATAGAGACC Chr14:21517489..21517508 60.04 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATTCCCGAGAATGACAGG Chr14:21515618..21515638 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAACTGCTTGCTCGTGAC Chr14:21515673..21515693 60.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039357