Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22236
Trapped Gene
Nfic (ENSMUSG00000055053)
Vector Insertion
Chr 10: 80872428 - 80883011
Public Clones IST14543G12 (tigm) IST14571H1 (tigm) IST14646H9 (tigm) IST14512B5 (tigm)
IST14498E4 (tigm) IST13155H12 (tigm) IST11226D12HMF1 (tigm) IST13909G5 (tigm)
IST13155H12 (tigm) IST14775H9 (tigm) IST13311G7 (tigm) IST12036A7 (tigm)
IST12036A7 (tigm)
Private Clones OST302748 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609202 (Chr10:80883012..80883543 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACCTGTACCTGGCCTAC Chr10:80883028..80883047 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609202 (Chr10:80883012..80883543 -)
Downstram Exon
ENSMUSE00000609201 (Chr10:80872356..80872427 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACCTGTACCTGGCCTAC Chr10:80883028..80883047 59.99 60 TGCTGTCCTCCTGGTCTGAG Chr10:80872349..80872368 61.59 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708050 Chr10:80893531..80893750 No primer for this exon
upstream ENSMUSE00000665813 Chr10:80889821..80889902 GATGTATTCCTCCCCGCTCT Chr10:80889832..80889851 60.43 55
upstream ENSMUSE00000609202 Chr10:80883012..80883543 TGGACCTGTACCTGGCCTAC Chr10:80883028..80883047 59.99 60

*** Putative Vector Insertion (Chr 10: 80872428 - 80883011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609201 Chr10:80872356..80872427 TGCTGTCCTCCTGGTCTGAG Chr10:80872349..80872368 61.59 60
downstream ENSMUSE00000609200 Chr10:80871080..80871154 TGAACACACCTGACGTGACA Chr10:80871088..80871107 59.74 50
downstream ENSMUSE00000609206 Chr10:80870946..80870974 No primer for this exon
downstream ENSMUSE00000609199 Chr10:80870851..80870974 TTCAGGTCATATGCCAGGTG Chr10:80870880..80870899 59.52 50
downstream ENSMUSE00000609198 Chr10:80870300..80870424 TGCTACTCGTGGGTGAGTTG Chr10:80870308..80870327 59.9 55
downstream ENSMUSE00000609204 Chr10:80868835..80868959 TGTGGTGTTGTGTGAAGCTG Chr10:80868836..80868855 59.32 50
downstream ENSMUSE00000102220 Chr10:80868834..80868959 TGTGGTGTTGTGTGAAGCTG Chr10:80868836..80868855 59.32 50
downstream ENSMUSE00000491816 Chr10:80867569..80867753 GGGAAGTAGGTGGAGGCTGT Chr10:80867647..80867666 60.51 60
downstream ENSMUSE00000495120 Chr10:80867569..80867715 GGGAAGTAGGTGGAGGCTGT Chr10:80867647..80867666 60.51 60
downstream ENSMUSE00000609197 Chr10:80866097..80866173 AAGAGGATCCCTCCGTCCTA Chr10:80866084..80866103 60.03 55
downstream ENSMUSE00000721179 Chr10:80863698..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55
downstream ENSMUSE00000383195 Chr10:80863647..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55
downstream ENSMUSE00000705337 Chr10:80863647..80863816 GGGGCTTCTCACTCCATCTA Chr10:80863676..80863695 59.24 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:80876941..80876961 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTCGTGACTGGGAAAACC Chr10:80876944..80876965 61.39 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTCAGTTTGCCTGCTTCTC Chr10:80877547..80877567 60.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTCAGTTTGCCTGCTTCTC Chr10:80877547..80877567 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055053