Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2224
Trapped Gene
Cks1b (ENSMUSG00000028044)
Vector Insertion
Chr 3: 89221940 - 89222076
Public Clones BC0046 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175427 (Chr3:89222077..89222200 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATACGACGACGAGGAGTTCG Chr3:89222084..89222103 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175427 (Chr3:89222077..89222200 -)
Downstram Exon
ENSMUSE00000673064 (Chr3:89221709..89221939 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATACGACGACGAGGAGTTCG Chr3:89222084..89222103 60.28 55 TTTACATCCTCCGTCCACCT Chr3:89221856..89221875 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175427 Chr3:89222077..89222200 ATACGACGACGAGGAGTTCG Chr3:89222084..89222103 60.28 55

*** Putative Vector Insertion (Chr 3: 89221940 - 89222076) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673064 Chr3:89221709..89221939 TTTACATCCTCCGTCCACCT Chr3:89221856..89221875 59.4 50
downstream ENSMUSE00000566837 Chr3:89220196..89220323 TAGTGGACCCATCCCTGACT Chr3:89220191..89220210 59.38 55
downstream ENSMUSE00000673062 Chr3:89220196..89220323 TAGTGGACCCATCCCTGACT Chr3:89220191..89220210 59.38 55
downstream ENSMUSE00000507910 Chr3:89219479..89219885 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50
downstream ENSMUSE00000175425 Chr3:89219396..89219885 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGGGACTACAGACAAAAG Chr3:89222043..89222063 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGCACGCGAGGAGTTAC Chr3:89222024..89222044 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028044