Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2225
Trapped Gene
Papd4 (ENSMUSG00000042167)
Vector Insertion
Chr 13: 93956432 - 93962048
Public Clones (sanger) BA0499 (sanger) (sanger) (sanger) E055A03 (ggtc) (ggtc)
P123C07 (ggtc) H004G03 (ggtc) (ggtc) D001G12 (ggtc) (ggtc)
H011E05 (ggtc) 5SP123C07 (ggtc) H003G06 (ggtc) (ggtc) P134C02 (ggtc)
H011E05 (ggtc) (ggtc) IST14515F11 (tigm) IST14757B6 (tigm)
Private Clones OST466724 (lexicon) OST418245 (lexicon) OST415097 (lexicon) OST311362 (lexicon)
OST303585 (lexicon) OST302922 (lexicon) OST282164 (lexicon) OST268844 (lexicon)
OST257803 (lexicon) OST248010 (lexicon) OST243748 (lexicon) OST242829 (lexicon)
OST210373 (lexicon) OST201997 (lexicon) OST197204 (lexicon) OST185654 (lexicon)
OST162260 (lexicon) OST157613 (lexicon) OST149303 (lexicon) OST147380 (lexicon)
OST134460 (lexicon) OST132538 (lexicon) OST118157 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303901 (Chr13:93962049..93962238 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTAGGCTCGTGACTCTC Chr13:93962195..93962214 59.19 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303901 (Chr13:93962049..93962238 -)
Downstram Exon
ENSMUSE00000303890 (Chr13:93956258..93956431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTAGGCTCGTGACTCTC Chr13:93962195..93962214 59.19 60 CCAAAATTGAGTTTGGGAACA Chr13:93956351..93956371 59.83 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000303901 Chr13:93962049..93962238 GCCTTAGGCTCGTGACTCTC Chr13:93962195..93962214 59.19 60

*** Putative Vector Insertion (Chr 13: 93956432 - 93962048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303890 Chr13:93956258..93956431 CCAAAATTGAGTTTGGGAACA Chr13:93956351..93956371 59.83 38.1
downstream ENSMUSE00000303881 Chr13:93955763..93955852 TTCCATATGTCAGGGGCTGT Chr13:93955790..93955809 60.34 50
downstream ENSMUSE00000303868 Chr13:93954034..93954271 GCCGTTTACCATCAAGAGGA Chr13:93954206..93954225 60.07 50
downstream ENSMUSE00000303857 Chr13:93945653..93945767 TTGCTTGCTGCTGACAAGTT Chr13:93945697..93945716 59.79 45
downstream ENSMUSE00000303849 Chr13:93945474..93945565 AAGCATAAATCGCCATCACTG Chr13:93945471..93945491 60.11 42.86
downstream ENSMUSE00000303838 Chr13:93944595..93944673 No primer for this exon
downstream ENSMUSE00000303822 Chr13:93941778..93941847 ATTGGCACTTTTGCTCGAAT Chr13:93941780..93941799 59.71 40
downstream ENSMUSE00000303809 Chr13:93938346..93938422 No primer for this exon
downstream ENSMUSE00000303799 Chr13:93937881..93938009 TCACCAGCACTAATGGACGA Chr13:93937955..93937974 60.26 50
downstream ENSMUSE00000303786 Chr13:93929600..93929643 AAGGATGGGTTCAGGTAGGG Chr13:93929602..93929621 60.18 55
downstream ENSMUSE00000303776 Chr13:93924880..93925016 GCATGATGAACAAGGTGCAG Chr13:93924951..93924970 60.27 50
downstream ENSMUSE00000303769 Chr13:93920639..93920730 TGGCTTCACGAACTGAAATC Chr13:93920674..93920693 58.85 45
downstream ENSMUSE00000303759 Chr13:93918836..93918915 CTGCTTCTCATGCACAGCTC Chr13:93918847..93918866 59.89 55
downstream ENSMUSE00000344724 Chr13:93917355..93917620 AAGGCAGCACACTGTTCAGA Chr13:93917550..93917569 59.62 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr13:93961977..93961998 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACTTGGTGGAGGAATTGG Chr13:93959004..93959024 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAAACTTGGTAATCGCCTTGC Chr13:93962176..93962197 59.27 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCCCTTTCTTTTTGTTGTC Chr13:93962247..93962267 58.53 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042167