Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22262
Trapped Gene
Kpna1 (ENSMUSG00000022905)
Vector Insertion
Chr 16: 36003037 - 36009401
Public Clones not available
Private Clones OST302104 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000131813 (Chr16:36002929..36003036 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCTGATGGTGGCTTTCAT Chr16:36002984..36003003 59.09 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000131813 (Chr16:36002929..36003036 +)
Downstram Exon
ENSMUSE00000131810 (Chr16:36009402..36009501 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCTGATGGTGGCTTTCAT Chr16:36002984..36003003 59.09 45 AGCTGCTGCTCTGGGCTATT Chr16:36009466..36009485 61.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000325289 Chr16:35983432..35983594 GAGCGTCTCCCTCTTCGTAGT Chr16:35983547..35983567 60.03 57.14
upstream ENSMUSE00000325278 Chr16:36000268..36000401 TGCAGTTACGGAAGCAGAAA Chr16:36000370..36000389 59.61 45
upstream ENSMUSE00000131813 Chr16:36002929..36003036 TGTCTGATGGTGGCTTTCAT Chr16:36002984..36003003 59.09 45

*** Putative Vector Insertion (Chr 16: 36003037 - 36009401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000131810 Chr16:36009402..36009501 AGCTGCTGCTCTGGGCTATT Chr16:36009466..36009485 61.57 55
downstream ENSMUSE00000559182 Chr16:36012979..36013073 CAAACCTGGCCACTACTCCT Chr16:36013038..36013057 59.21 55
downstream ENSMUSE00000131806 Chr16:36019344..36019475 CTGAATCACATTCCGGGTCT Chr16:36019415..36019434 59.93 50
downstream ENSMUSE00000131807 Chr16:36020242..36020330 GACATAGTCCCTGCACATGGT Chr16:36020300..36020320 59.87 52.38
downstream ENSMUSE00000131809 Chr16:36020774..36020873 GAGGTGGGCTCTTCCCTCTA Chr16:36020862..36020881 60.72 60
downstream ENSMUSE00000559178 Chr16:36021571..36021734 GAAGTTCCACAAGCCTCCTG Chr16:36021733..36021752 59.84 55
downstream ENSMUSE00000131808 Chr16:36023261..36023339 GTGACAATGTTTCCCACAGC Chr16:36023320..36023339 58.99 50
downstream ENSMUSE00000131800 Chr16:36029608..36029733 TTCCTTTGGGCTACTCAGCA Chr16:36029670..36029689 60.9 50
downstream ENSMUSE00000131803 Chr16:36031256..36031383 CTTCCTTGTCCGGAACTCTG Chr16:36031330..36031349 59.84 55
downstream ENSMUSE00000131812 Chr16:36033338..36033516 GCCATTTAGGGCAACCTGTA Chr16:36033428..36033447 59.96 50
downstream ENSMUSE00000468115 Chr16:36033807..36037217 GCAAATGAGCGCAAACAGTA Chr16:36034123..36034142 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGAGATGGCACCAGTAA Chr16:36003022..36003042 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGGAGATGGCACCAGTAA Chr16:36003022..36003042 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022905