Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22279
Trapped Gene
Acvr2b (ENSMUSG00000061393)
Vector Insertion
Chr 9: 119311716 - 119336572
Public Clones (sanger) E325E06 (ggtc) E323B07 (ggtc)
Private Clones OST301791 (lexicon) OST215486 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497501 (Chr9:119311562..119311715 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCTCTGGGGATCGCTGTG Chr9:119311691..119311710 63.24 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497501 (Chr9:119311562..119311715 +)
Downstram Exon
ENSMUSE00000496474 (Chr9:119336573..119336780 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCTCTGGGGATCGCTGTG Chr9:119311691..119311710 63.24 60 CTCCCAGTTGGCGTTGTAGT Chr9:119336634..119336653 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497501 Chr9:119311562..119311715 CTTCTCTGGGGATCGCTGTG Chr9:119311691..119311710 63.24 60

*** Putative Vector Insertion (Chr 9: 119311716 - 119336572) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496474 Chr9:119336573..119336780 CTCCCAGTTGGCGTTGTAGT Chr9:119336634..119336653 60.17 55
downstream ENSMUSE00000582985 Chr9:119337085..119337194 GTACACCTGGGGGTTCTCCT Chr9:119337127..119337146 60.23 60
downstream ENSMUSE00000450044 Chr9:119337319..119337686 GCTTAAAGGAGTCCGCACAG Chr9:119337531..119337550 60.01 55
downstream ENSMUSE00000688697 Chr9:119337319..119337470 GGCTTCCGATGACGATACAT Chr9:119337445..119337464 59.92 50
downstream ENSMUSE00000688696 Chr9:119337543..119337686 TCACAGCCACAAAGTCGTTC Chr9:119337672..119337691 59.88 50
downstream ENSMUSE00000582984 Chr9:119338983..119339126 GTGCTGAAGATTTCCCGTTC Chr9:119339026..119339045 59.68 50
downstream ENSMUSE00000582983 Chr9:119339338..119339486 GTTCGTTCCACGTGATGATG Chr9:119339389..119339408 59.97 50
downstream ENSMUSE00000582982 Chr9:119340342..119340456 GGTCGCTCTTCAGCAGTACA Chr9:119340382..119340401 59.19 55
downstream ENSMUSE00000582981 Chr9:119341607..119341745 AGGCGTCTCTCTGGAAGTTG Chr9:119341676..119341695 59.6 55
downstream ENSMUSE00000582980 Chr9:119341831..119341961 TAATCGTGGGCCTCATCTTC Chr9:119341941..119341960 60.04 50
downstream ENSMUSE00000503618 Chr9:119342385..119342619 GCTGGACTCTTTAGGGAGCA Chr9:119342576..119342595 59.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGAAGGCAGGGTTGGTGTT Chr9:119317705..119317725 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGAAGGCAGGGTTGGTGTT Chr9:119317705..119317725 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061393