Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22289
Trapped Gene
Higd1a (ENSMUSG00000038412)
Vector Insertion
Chr 9: 121759441 - 121761608
Public Clones not available
Private Clones OST301508 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406807 (Chr9:121761609..121761727 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGATGAAGGTCAGGGGTCTA Chr9:121761651..121761670 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406807 (Chr9:121761609..121761727 -)
Downstram Exon
ENSMUSE00000688123 (Chr9:121759306..121759440 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGATGAAGGTCAGGGGTCTA Chr9:121761651..121761670 60.06 55 ACACGCATGTGGATCAAGTG Chr9:121759322..121759341 60.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460988 Chr9:121766630..121766722 No primer for this exon
upstream ENSMUSE00000406807 Chr9:121761609..121761727 CGATGAAGGTCAGGGGTCTA Chr9:121761651..121761670 60.06 55

*** Putative Vector Insertion (Chr 9: 121759441 - 121761608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688123 Chr9:121759306..121759440 ACACGCATGTGGATCAAGTG Chr9:121759322..121759341 60.6 50
downstream ENSMUSE00000364583 Chr9:121758657..121758807 TTGGCCCAGAATTCCTGATA Chr9:121758749..121758768 60.4 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTTTGTCCCCATTGGTAAG Chr9:121761602..121761622 60.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTTTGTCCCCATTGGTAAG Chr9:121761602..121761622 60.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038412