Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22292
Trapped Gene
Adamts14 (ENSMUSG00000059901)
Vector Insertion
Chr 10: 60693250 - 60708673
Public Clones (ggtc) IST12527H2 (tigm) IST14298G11 (tigm) IST12509H2 (tigm) IST10090C1 (tigm)
IST14556D2 (tigm) IST12578D6 (tigm) IST13255E5 (tigm) IST12087E9 (tigm)
IST13367E8 (tigm) IST14758H9 (tigm) IST14319E12 (tigm) IST14770F3 (tigm)
IST14907F5 (tigm) IST12578D6 (tigm) IST14780D10 (tigm) IST10569E4 (tigm)
IST15032D12 (tigm) IST10483C3 (tigm) IST11292E6 (tigm) IST13367E8 (tigm)
Private Clones OST301407 (lexicon) OST265085 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576048 (Chr10:60708674..60708864 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGGAGCATACGCAGAACT Chr10:60708697..60708716 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576048 (Chr10:60708674..60708864 -)
Downstram Exon
ENSMUSE00000482142 (Chr10:60693166..60693249 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGGAGCATACGCAGAACT Chr10:60708697..60708716 60.42 55 CAGCGATTCGTCATGGTAAA Chr10:60693198..60693217 59.69 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666275 Chr10:60735904..60736186 No primer for this exon
upstream ENSMUSE00000713901 Chr10:60735904..60735990 No primer for this exon
upstream ENSMUSE00000576050 Chr10:60733605..60734005 AGATTTCCAGGGACGCTTCT Chr10:60733931..60733950 60.21 50
upstream ENSMUSE00000576049 Chr10:60712352..60712508 TGGTGACCTTCACAACGAAG Chr10:60712352..60712371 59.72 50
upstream ENSMUSE00000576048 Chr10:60708674..60708864 CAGGGAGCATACGCAGAACT Chr10:60708697..60708716 60.42 55

*** Putative Vector Insertion (Chr 10: 60693250 - 60708673) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482142 Chr10:60693166..60693249 CAGCGATTCGTCATGGTAAA Chr10:60693198..60693217 59.69 45
downstream ENSMUSE00000576042 Chr10:60692404..60692551 GACGTGGTCGTGATGTTCAG Chr10:60692416..60692435 60.16 55
downstream ENSMUSE00000717226 Chr10:60692395..60692551 GACGTGGTCGTGATGTTCAG Chr10:60692416..60692435 60.16 55
downstream ENSMUSE00000576047 Chr10:60689855..60689960 TCTCATGAGCCACGACAAAA Chr10:60689843..60689862 60.39 45
downstream ENSMUSE00000491823 Chr10:60688085..60688228 AGACCAGTGGAACCTGTGGA Chr10:60688098..60688117 60.56 55
downstream ENSMUSE00000490386 Chr10:60687021..60687153 GTCATCAAGGAGGCAATCGT Chr10:60687107..60687126 60.08 50
downstream ENSMUSE00000576046 Chr10:60685532..60685645 CCCTTCTTGGTCTTGCAGAA Chr10:60685547..60685566 60.37 50
downstream ENSMUSE00000486699 Chr10:60684606..60684754 CACACGACCGAGAACATGAG Chr10:60684627..60684646 60.31 55
downstream ENSMUSE00000484980 Chr10:60681106..60681281 CTCAAACATGGACCCTGAGC Chr10:60681217..60681236 60.66 55
downstream ENSMUSE00000507297 Chr10:60676278..60676411 CCCATCGTGGACTACTTGGT Chr10:60676310..60676329 59.84 55
downstream ENSMUSE00000513248 Chr10:60675872..60675995 GCACTTGTCATCCGTCTTCA Chr10:60675923..60675942 59.84 50
downstream ENSMUSE00000512229 Chr10:60674336..60674416 GGGATCTGCACCTGTTTGAG Chr10:60674370..60674389 60.66 55
downstream ENSMUSE00000518023 Chr10:60670048..60670211 CTTCGTGCTCCCACTCTAGG Chr10:60670088..60670107 60.01 60
downstream ENSMUSE00000509589 Chr10:60668112..60668280 GCCCATTCGTAGGTGTCTGT Chr10:60668131..60668150 60 55
downstream ENSMUSE00000508548 Chr10:60667595..60667727 AGGCTTGGGCCTCTTTTTAT Chr10:60667614..60667633 59.22 45
downstream ENSMUSE00000500118 Chr10:60665571..60665778 CTACAGGCACCCCACTCTTC Chr10:60665727..60665746 59.72 60
downstream ENSMUSE00000505959 Chr10:60663924..60664053 No primer for this exon
downstream ENSMUSE00000511920 Chr10:60663111..60663221 ACCTCCGCCTTCACTGTAGA Chr10:60663166..60663185 59.87 55
downstream ENSMUSE00000712810 Chr10:60661216..60661707 ACGGTCCAACACTTCCATTC Chr10:60661630..60661649 59.83 50
downstream ENSMUSE00000576036 Chr10:60659860..60661707 CTGGTCTAACCAGGGACCAA Chr10:60660411..60660430 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:60693603..60693623 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCCTCCTCATACGTGA Chr10:60693617..60693637 60.61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCAGCATCCTCCTTTCACC Chr10:60693827..60693847 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCAGCATCCTCCTTTCACC Chr10:60693827..60693847 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059901