Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22301
Trapped Gene
Eef1a1 (ENSMUSG00000037742)
Vector Insertion
Chr 9: 78328496 - 78329445
Public Clones PST22671-NR (escells) IST14183F10 (tigm)
Private Clones OST301237 (lexicon) OST266489 (lexicon) OST262135 (lexicon) OST240552 (lexicon)
OST182027 (lexicon) OST110549 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695236 (Chr9:78329446..78329478 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695236 (Chr9:78329446..78329478 -)
Downstram Exon
ENSMUSE00000389615 (Chr9:78328318..78328495 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCGATTACGACGATGTTGA Chr9:78328398..78328417 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695236 Chr9:78329446..78329478 No primer for this exon

*** Putative Vector Insertion (Chr 9: 78328496 - 78329445) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389615 Chr9:78328318..78328495 TCCGATTACGACGATGTTGA Chr9:78328398..78328417 60.07 45
downstream ENSMUSE00000531577 Chr9:78328048..78328227 TTTGCTGGTCTCGAATTTCC Chr9:78328098..78328117 60.19 45
downstream ENSMUSE00000531576 Chr9:78327659..78327955 TTGTCACCATTCCAACCAGA Chr9:78327659..78327678 59.94 45
downstream ENSMUSE00000531575 Chr9:78327431..78327581 TTGTCAGTTGGACGAGTTGG Chr9:78327450..78327469 59.72 50
downstream ENSMUSE00000531574 Chr9:78327085..78327341 CCAGGCTTGAGAACACCAGT Chr9:78327268..78327287 60.3 55
downstream ENSMUSE00000531573 Chr9:78326765..78326999 TCGCCAGACTTCAGGAACTT Chr9:78326814..78326833 59.99 50
downstream ENSMUSE00000269551 Chr9:78326265..78326665 CCGTTCTTCCACCACTGATT Chr9:78326467..78326486 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGTCCTGCTCTAATCG Chr9:78329388..78329408 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGACGTTCTTTTTCGCAAC Chr9:78329465..78329485 61.18 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGTATATAAGTGCGGCAGTC Chr9:78329489..78329510 59.64 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGGTATATAAGTGCGGCAGTC Chr9:78329489..78329510 59.64 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037742