Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22303
Trapped Gene
Lysmd3 (ENSMUSG00000035840)
Vector Insertion
Chr 13: 81796936 - 81804003
Public Clones (ggtc)
Private Clones OST301226 (lexicon) OST206210 (lexicon) OST178184 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377156 (Chr13:81796805..81796935 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCGGAGAACCTAGAGTCG Chr13:81796843..81796862 59.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377156 (Chr13:81796805..81796935 +)
Downstram Exon
ENSMUSE00000248867 (Chr13:81804004..81804268 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCGGAGAACCTAGAGTCG Chr13:81796843..81796862 59.86 60 CCTGGACCGAAGTTCGTAGA Chr13:81804151..81804170 60.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377156 Chr13:81796805..81796935 CACCGGAGAACCTAGAGTCG Chr13:81796843..81796862 59.86 60

*** Putative Vector Insertion (Chr 13: 81796936 - 81804003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248867 Chr13:81804004..81804268 CCTGGACCGAAGTTCGTAGA Chr13:81804151..81804170 60.25 55
downstream ENSMUSE00000332243 Chr13:81808160..81810887 AAAACCCACGCAAATCAGAC Chr13:81810160..81810179 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGCTAGAGGACAGGTGA Chr13:81796921..81796941 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGCTAGAGGACAGGTGA Chr13:81796921..81796941 60.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035840