Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2231
Trapped Gene
Brd4 (ENSMUSG00000024002)
Vector Insertion
Chr 17: 32335508 - 32335627
Public Clones AS0512 (sanger) AD0200 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137091 (Chr17:32335628..32335758 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACAGAAGCAGGAGCCAAA Chr17:32335650..32335669 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137091 (Chr17:32335628..32335758 -)
Downstram Exon
ENSMUSE00000137087 (Chr17:32335302..32335507 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACAGAAGCAGGAGCCAAA Chr17:32335650..32335669 59.99 45 ACTTGAGGACTTGGCTGTGG Chr17:32335399..32335418 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381701 Chr17:32421008..32421054 AAGCGACTGCCTCTGGATCT Chr17:32421027..32421046 61.47 55
upstream ENSMUSE00000709740 Chr17:32421008..32421042 No primer for this exon
upstream ENSMUSE00000311138 Chr17:32389986..32390145 CTTTCCGTCTGGACACAACA Chr17:32390048..32390067 59.72 50
upstream ENSMUSE00000711517 Chr17:32389942..32390145 CTTTCCGTCTGGACACAACA Chr17:32390048..32390067 59.72 50
upstream ENSMUSE00000311117 Chr17:32366362..32366680 CAACCCTAACAAGCCCAAGA Chr17:32366475..32366494 60.1 50
upstream ENSMUSE00000714803 Chr17:32366362..32366680 CAACCCTAACAAGCCCAAGA Chr17:32366475..32366494 60.1 50
upstream ENSMUSE00000547604 Chr17:32362521..32362658 AAGAAGCGCTTGGAAAACAA Chr17:32362594..32362613 60 40
upstream ENSMUSE00000699480 Chr17:32361032..32361167 AGAGGACGAGGGAGGAAAGA Chr17:32361037..32361056 60.33 55
upstream ENSMUSE00000137065 Chr17:32361029..32361167 AGAGGACGAGGGAGGAAAGA Chr17:32361037..32361056 60.33 55
upstream ENSMUSE00000137074 Chr17:32358818..32359110 TGGTGTATCCACGGTACCAA Chr17:32359078..32359097 59.69 50
upstream ENSMUSE00000137093 Chr17:32358091..32358453 GCAGCTAAAGTGCTGCAGTG Chr17:32358228..32358247 59.96 55
upstream ENSMUSE00000137069 Chr17:32357106..32357234 TGCTGATGTCCGATTGATGT Chr17:32357171..32357190 60.08 45
upstream ENSMUSE00000137090 Chr17:32351576..32351785 GACAGCGACAGTTCCACTGA Chr17:32351625..32351644 60.03 55
upstream ENSMUSE00000310929 Chr17:32350472..32350671 AGCAGCAACAGCAATGTGAG Chr17:32350472..32350491 60.21 50
upstream ENSMUSE00000137079 Chr17:32349784..32350079 GGAACCAGTACCCACGAAGA Chr17:32350054..32350073 59.97 55
upstream ENSMUSE00000547571 Chr17:32348112..32348222 ACGTGATTGCTGGTTCTTCC Chr17:32348191..32348210 60.12 50
upstream ENSMUSE00000699479 Chr17:32343614..32343938 ATTCCTTCCCAGCGAGCTAT Chr17:32343866..32343885 60.19 50
upstream ENSMUSE00000713464 Chr17:32341855..32343940 GCTGGGGTTGAAATCAGTGT Chr17:32341973..32341992 59.97 50
upstream ENSMUSE00000137081 Chr17:32339613..32339665 AGATGGCTCCCAAGTCAAAA Chr17:32339646..32339665 59.67 45
upstream ENSMUSE00000137082 Chr17:32339119..32339491 TTGACCCTATTGGCCACTTC Chr17:32339231..32339250 59.93 50
upstream ENSMUSE00000137070 Chr17:32337947..32338537 ACCACTACTCCCTTCCGTGA Chr17:32338274..32338293 59.57 55
upstream ENSMUSE00000310779 Chr17:32335841..32336215 ATCTTCGTGAGGCTCCCTCT Chr17:32336193..32336212 60.36 55
upstream ENSMUSE00000137091 Chr17:32335628..32335758 AAACAGAAGCAGGAGCCAAA Chr17:32335650..32335669 59.99 45

*** Putative Vector Insertion (Chr 17: 32335508 - 32335627) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137087 Chr17:32335302..32335507 ACTTGAGGACTTGGCTGTGG Chr17:32335399..32335418 60.3 55
downstream ENSMUSE00000137078 Chr17:32334976..32335219 CTGCTGCTGCTCCTGTCTCT Chr17:32335086..32335105 61.05 60
downstream ENSMUSE00000423965 Chr17:32333221..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55
downstream ENSMUSE00000711346 Chr17:32333219..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGAAGCAGGAGCCAAAAA Chr17:32335646..32335666 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGAAGCAGGAGCCAAAAA Chr17:32335646..32335666 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024002