Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22334
Trapped Gene
Ifi35 (ENSMUSG00000010358)
Vector Insertion
Chr 11: 101317979 - 101318503
Public Clones not available
Private Clones OST299990 (lexicon) OST155729 (lexicon) OST68585 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000585850 (Chr11:101317880..101317978 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000585850 (Chr11:101317880..101317978 +)
Downstram Exon
ENSMUSE00000113027 (Chr11:101318504..101318651 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000585851 Chr11:101309795..101309936 No primer for this exon
upstream ENSMUSE00000585850 Chr11:101317880..101317978 No primer for this exon

*** Putative Vector Insertion (Chr 11: 101317979 - 101318503) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113027 Chr11:101318504..101318651 No primer for this exon
downstream ENSMUSE00000113024 Chr11:101318730..101318836 No primer for this exon
downstream ENSMUSE00000113025 Chr11:101318934..101319120 No primer for this exon
downstream ENSMUSE00000113023 Chr11:101319205..101319311 No primer for this exon
downstream ENSMUSE00000240598 Chr11:101319515..101319776 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTGGGAACTGAGGTGTT Chr11:101317982..101318002 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTGGGAACTGAGGTGTT Chr11:101317982..101318002 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010358