Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22338
Trapped Gene
A530082C11Rik (ENSMUSG00000042202)
Vector Insertion
Chr 4: 154983947 - 154984429
Public Clones not available
Private Clones OST299860 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714465 (Chr4:154983948..154984428 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGGTGTGTGGAGTTCAA Chr4:154984307..154984326 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714465 (Chr4:154983948..154984428 +)
Downstram Exon
ENSMUSE00000385931 (Chr4:154983948..154984428 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGGTGTGTGGAGTTCAA Chr4:154984307..154984326 60.13 50 ACTGCGCAGACAGAGAGACA Chr4:154984054..154984073 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666868 Chr4:154975525..154975847 GTTCCGGAATGTACCACAGG Chr4:154975681..154975700 60.23 55
upstream ENSMUSE00000629991 Chr4:154975720..154975911 No primer for this exon
upstream ENSMUSE00000720362 Chr4:154976053..154976271 CTTGACTCTGGACCGCTCTG Chr4:154976063..154976082 61.14 60

*** Putative Vector Insertion (Chr 4: 154983947 - 154984429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385931 Chr4:154983948..154984428 ACTGCGCAGACAGAGAGACA Chr4:154984054..154984073 59.92 55
downstream ENSMUSE00000714465 Chr4:154983948..154984428 ACTGCGCAGACAGAGAGACA Chr4:154984054..154984073 59.92 55
downstream ENSMUSE00000364267 Chr4:154984610..154984745 GAGGCCCACAAAGAGCATAG Chr4:154984743..154984762 59.84 55
downstream ENSMUSE00000351054 Chr4:154985725..154985852 CCCAGAATCATCCGAGACAT Chr4:154985844..154985863 59.89 50
downstream ENSMUSE00000354819 Chr4:154986726..154986846 AGCTTATTTCCGTGGCAGTG Chr4:154986800..154986819 60.27 50
downstream ENSMUSE00000385437 Chr4:154989678..154989731 CGGTATTTGTCCCCACTGAG Chr4:154989728..154989747 60.37 55
downstream ENSMUSE00000360714 Chr4:154990292..154990364 CATGAAGAAGGTCCATGCTG Chr4:154990367..154990386 59.24 50
downstream ENSMUSE00000387278 Chr4:154991724..154991869 CTGAACGTCACAGGGGAGAT Chr4:154991872..154991891 60.11 55
downstream ENSMUSE00000368567 Chr4:154992621..154994199 ATGGGCAATCACAAAATGGT Chr4:154993401..154993420 60.06 40
downstream ENSMUSE00000666862 Chr4:154992621..154995132 ATGGGCAATCACAAAATGGT Chr4:154993401..154993420 60.06 40
downstream ENSMUSE00000666864 Chr4:154992621..154997449 TGCCAACATTGAACGAACAT Chr4:154997228..154997247 59.97 40
downstream ENSMUSE00000705429 Chr4:154992621..154995137 ATGGGCAATCACAAAATGGT Chr4:154993401..154993420 60.06 40
downstream ENSMUSE00000717805 Chr4:154992621..154993428 ATGGGCAATCACAAAATGGT Chr4:154993401..154993420 60.06 40
downstream ENSMUSE00000666861 Chr4:154995626..154996015 GAGCAACATGGCAGCTCATA Chr4:154995770..154995789 59.98 50
downstream ENSMUSE00000666860 Chr4:154996461..154997447 TGCCAACATTGAACGAACAT Chr4:154997228..154997247 59.97 40
downstream ENSMUSE00000705428 Chr4:155084561..155084606 TATTTGTTCTTGCTGGGCAGT Chr4:155084599..155084619 59.76 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAACATTCTAATCGCCTTGC Chr4:154983989..154984010 60.22 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTCCGTGACTGGGAAAAC Chr4:154983993..154984013 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042202