Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2235
Trapped Gene
Hip2 (ENSMUSG00000029203)
Vector Insertion
Chr 5: 65985788 - 65986113
Public Clones AH0120 (sanger) AD0538 (sanger) AL0850 (sanger)
Private Clones OST241057 (lexicon) OST238522 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186858 (Chr5:65985659..65985787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGACAGCTCGACTTTGG Chr5:65985684..65985703 60.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186858 (Chr5:65985659..65985787 +)
Downstram Exon
ENSMUSE00000254330 (Chr5:65986114..65986379 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGACAGCTCGACTTTGG Chr5:65985684..65985703 60.73 55 CAGCTCCTGTGCCTCAGTTA Chr5:65986204..65986223 59.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716543 Chr5:65928539..65928785 CGCGGAGGTGATTCTACAGT Chr5:65928545..65928564 60.28 55
upstream ENSMUSE00000254377 Chr5:65928570..65928785 GAATCAAGCGGGAGTTCAAG Chr5:65928745..65928764 59.81 50
upstream ENSMUSE00000254368 Chr5:65957228..65957321 CCTCCAGACACACCGTATGA Chr5:65957300..65957319 59.54 55
upstream ENSMUSE00000254358 Chr5:65962771..65962829 No primer for this exon
upstream ENSMUSE00000254349 Chr5:65972625..65972707 CGTCACAGGGGCTATTTGTT Chr5:65972666..65972685 59.99 50
upstream ENSMUSE00000186857 Chr5:65983115..65983214 TGACTCTGCGCACGGTATTA Chr5:65983126..65983145 60.42 50
upstream ENSMUSE00000186858 Chr5:65985659..65985787 AGCAGACAGCTCGACTTTGG Chr5:65985684..65985703 60.73 55

*** Putative Vector Insertion (Chr 5: 65985788 - 65986113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254330 Chr5:65986114..65986379 CAGCTCCTGTGCCTCAGTTA Chr5:65986204..65986223 59.19 55
downstream ENSMUSE00000710549 Chr5:65986114..65987632 TGAGAATCTCCGCTCTGGAT Chr5:65986775..65986794 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:65985838..65985858 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGTTACGTGACTGGGAAAA Chr5:65985832..65985853 60.15 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029203