Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22378
Trapped Gene
Sestd1 (ENSMUSG00000042272)
Vector Insertion
Chr 2: 77103826 - 77118611
Public Clones IST13224H9 (tigm) IST10856B10 (tigm) IST14125H8 (tigm) IST14121H8 (tigm)
Private Clones OST298987 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662215 (Chr2:77118612..77118649 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662215 (Chr2:77118612..77118649 -)
Downstram Exon
ENSMUSE00000662220 (Chr2:77103733..77103825 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAAAGACAGCAGGCCTCTCC Chr2:77103733..77103752 60.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418402 Chr2:77129139..77129163 No primer for this exon
upstream ENSMUSE00000662215 Chr2:77118612..77118649 No primer for this exon

*** Putative Vector Insertion (Chr 2: 77103826 - 77118611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662220 Chr2:77103733..77103825 AAAAGACAGCAGGCCTCTCC Chr2:77103733..77103752 60.9 55
downstream ENSMUSE00000326891 Chr2:77083074..77083146 CATTTCACGTCCTTGCCTCT Chr2:77083104..77083123 60.26 50
downstream ENSMUSE00000662219 Chr2:77083074..77083143 AAAGGAAGGCCAGCTTCTTC Chr2:77083055..77083074 59.96 50
downstream ENSMUSE00000326885 Chr2:77079670..77079778 AGTCCACTGCGTCTGTCCTT Chr2:77079732..77079751 59.91 55
downstream ENSMUSE00000326878 Chr2:77072706..77072796 TGAGACTTCCTGCCATCCAC Chr2:77072721..77072740 61.23 55
downstream ENSMUSE00000326872 Chr2:77068721..77068834 ATACCTCGGCTGGAACAACA Chr2:77068791..77068810 60.52 50
downstream ENSMUSE00000326866 Chr2:77056146..77056259 TCTTCTGTCAACTGGCATGG Chr2:77056176..77056195 59.83 50
downstream ENSMUSE00000326860 Chr2:77054980..77055077 CCTGCTCATTCCCCTTATCA Chr2:77054968..77054987 60.03 50
downstream ENSMUSE00000326856 Chr2:77053119..77053174 GGATCAACGGATGGAAGAAA Chr2:77053117..77053136 59.87 45
downstream ENSMUSE00000326851 Chr2:77050417..77050628 ACTTCATAACCTGCGGCTGT Chr2:77050496..77050515 59.76 50
downstream ENSMUSE00000326844 Chr2:77044263..77044385 TTGGCTCTCGATCTCCTCAT Chr2:77044247..77044266 59.91 50
downstream ENSMUSE00000326839 Chr2:77036923..77037117 CCTCGTCTCCAGCGTTTAAG Chr2:77037029..77037048 60.01 55
downstream ENSMUSE00000326834 Chr2:77036346..77036460 CATCCCTAATAAGCCGTCCA Chr2:77036406..77036425 59.92 50
downstream ENSMUSE00000662218 Chr2:77034880..77035039 TTGACCTTTTTCTCGCAAGC Chr2:77034983..77035002 60.5 45
downstream ENSMUSE00000662217 Chr2:77030556..77030637 CTCCGCACATCTACCATGTC Chr2:77030589..77030608 59.12 55
downstream ENSMUSE00000326809 Chr2:77029756..77029878 GCCTGATATGGGTCTTCAGC Chr2:77029802..77029821 59.66 55
downstream ENSMUSE00000326802 Chr2:77029018..77029209 GCATTGGAGTGAAAGGCAAT Chr2:77029003..77029022 60.08 45
downstream ENSMUSE00000326792 Chr2:77026557..77026678 GGTAAACCACGGGGATAGTG Chr2:77026542..77026561 59.17 55
downstream ENSMUSE00000662214 Chr2:77024612..77025317 TGCATCTTAACGAGCTGTGG Chr2:77025076..77025095 60.01 50
downstream ENSMUSE00000662216 Chr2:77018397..77025317 AAAGGTGACACAGGGTGAGG Chr2:77023855..77023874 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:77106541..77106561 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTCAGCATCGTGACTGG Chr2:77106551..77106571 60.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCAGGGTTGAAGGAGACTG Chr2:77106676..77106696 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CATCTGTTTTGTTTGCGTGAC Chr2:77109593..77109614 59.23 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042272