Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22384
Trapped Gene
Peli1 (ENSMUSG00000020134)
Vector Insertion
Chr 11: 20991682 - 21036048
Public Clones (sanger) (sanger) (sanger) (sanger) 5SE053F05 (ggtc) 3SE053F05 (ggtc)
IST14499D9 (tigm) IST14472D5 (tigm)
Private Clones OST298865 (lexicon) OST170461 (lexicon) OST148334 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000580916 (Chr11:20991327..20991681 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000580916 (Chr11:20991327..20991681 +)
Downstram Exon
ENSMUSE00000580915 (Chr11:21036049..21036188 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000580916 Chr11:20991327..20991681 No primer for this exon

*** Putative Vector Insertion (Chr 11: 20991682 - 21036048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655292 Chr11:21035472..21036188 No primer for this exon
downstream ENSMUSE00000580915 Chr11:21036049..21036188 No primer for this exon
downstream ENSMUSE00000410899 Chr11:21040567..21040696 No primer for this exon
downstream ENSMUSE00000101063 Chr11:21042559..21042660 No primer for this exon
downstream ENSMUSE00000101074 Chr11:21046918..21047115 No primer for this exon
downstream ENSMUSE00000580914 Chr11:21047261..21047449 No primer for this exon
downstream ENSMUSE00000580913 Chr11:21047960..21050329 No primer for this exon
downstream ENSMUSE00000655289 Chr11:21047960..21050326 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:21021732..21021752 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATATTCCTCCCACCTCATT Chr11:21021655..21021676 60.03 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020134