Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22386
Trapped Gene
Topors (ENSMUSG00000036822)
Vector Insertion
Chr 4: 40215535 - 40216706
Public Clones (sanger) 3SD046C05 (ggtc) (ggtc) 5SP138B03 (ggtc) 3SP098F02 (ggtc)
3SP138B03 (ggtc) (ggtc) IST14221H6 (tigm) IST13870D8 (tigm) IST11637H9 (tigm)
IST12693F2 (tigm)
Private Clones OST298853 (lexicon) OST209253 (lexicon) OST144066 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675605 (Chr4:40216707..40216874 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGAGCCAACAGTCTACCTT Chr4:40216809..40216828 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675605 (Chr4:40216707..40216874 -)
Downstram Exon
ENSMUSE00000297854 (Chr4:40215337..40215534 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGAGCCAACAGTCTACCTT Chr4:40216809..40216828 59.5 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675605 Chr4:40216707..40216874 GCGAGCCAACAGTCTACCTT Chr4:40216809..40216828 59.5 55

*** Putative Vector Insertion (Chr 4: 40215535 - 40216706) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297854 Chr4:40215337..40215534 No primer for this exon
downstream ENSMUSE00000345531 Chr4:40206649..40210114 CGGCGACCGTGAAGTATTAT Chr4:40207588..40207607 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTCATCGGCCTCATGGTA Chr4:40216702..40216722 61.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCATCGGCCTCATGGTA Chr4:40216702..40216722 61.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAGTTCCAAGCTGCGTAAT Chr4:40216820..40216840 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000036822