Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22389
Trapped Gene
Fkbp11 (ENSMUSG00000003355)
Vector Insertion
Chr 15: 98557730 - 98558113
Public Clones IST14267C5 (tigm)
Private Clones OST298786 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132539 (Chr15:98558114..98558179 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132539 (Chr15:98558114..98558179 -)
Downstram Exon
ENSMUSE00000132540 (Chr15:98557642..98557729 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000132535 Chr15:98558388..98558629 No primer for this exon
upstream ENSMUSE00000132539 Chr15:98558114..98558179 No primer for this exon

*** Putative Vector Insertion (Chr 15: 98557730 - 98558113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132540 Chr15:98557642..98557729 No primer for this exon
downstream ENSMUSE00000132536 Chr15:98557331..98557364 No primer for this exon
downstream ENSMUSE00000132537 Chr15:98556915..98556985 No primer for this exon
downstream ENSMUSE00000401953 Chr15:98554801..98555033 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGACACGCTCCACATAC Chr15:98558120..98558140 59.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGACACGCTCCACATAC Chr15:98558120..98558140 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTAGGAGGAGCAGCCTTGA Chr15:98558198..98558218 59.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCAGCCTTGACCCTTGTAG Chr15:98558189..98558209 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003355