Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2241
Trapped Gene
Mllt4 (ENSMUSG00000068036)
Vector Insertion
Chr 17: 13989467 - 13990926
Public Clones AL0482 (sanger) RRI400 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433583 (Chr17:13989323..13989466 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGATGAGCCTTTTATTCC Chr17:13989443..13989462 60.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433583 (Chr17:13989323..13989466 +)
Downstram Exon
ENSMUSE00000703720 (Chr17:13990927..13990941 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGATGAGCCTTTTATTCC Chr17:13989443..13989462 60.76 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703721 Chr17:13898612..13899010 GACTTAATTTTGCCGGTGGA Chr17:13898895..13898914 59.94 45
upstream ENSMUSE00000242801 Chr17:13940946..13941141 TAGCACAGCCACCACTCAAG Chr17:13941029..13941048 60.05 55
upstream ENSMUSE00000136121 Chr17:13944284..13944399 ATGATCGAGAGGGTCGATTC Chr17:13944344..13944363 59.05 50
upstream ENSMUSE00000136125 Chr17:13945939..13946102 AATGGACCTGAAAAGCAGGA Chr17:13945951..13945970 59.67 45
upstream ENSMUSE00000403483 Chr17:13947417..13947577 GAGTTTCGGAGCTCAGATGG Chr17:13947544..13947563 59.95 55
upstream ENSMUSE00000433661 Chr17:13955128..13955285 GCTGTAGCCGAATCTTTGGA Chr17:13955217..13955236 60.35 50
upstream ENSMUSE00000480607 Chr17:13959273..13959384 GGAATGGCCAAGTGACAAAG Chr17:13959365..13959384 60.49 50
upstream ENSMUSE00000513922 Chr17:13960298..13960465 GAGGAGACCACCGGACTACA Chr17:13960320..13960339 60.11 60
upstream ENSMUSE00000433633 Chr17:13965936..13966030 CCGCCTTCAATTAAGTGTGAC Chr17:13965970..13965990 59.62 47.62
upstream ENSMUSE00000433627 Chr17:13966877..13967139 TGCAGAGACCTACGTGGATG Chr17:13966960..13966979 59.85 55
upstream ENSMUSE00000433619 Chr17:13969375..13969444 TGGGAGGAGATGTCCACAGT Chr17:13969401..13969420 60.53 55
upstream ENSMUSE00000433614 Chr17:13972245..13972363 GGAGCAGGAATATCGACGAC Chr17:13972334..13972353 59.66 55
upstream ENSMUSE00000433610 Chr17:13983279..13983340 ATGCTACTGGGCCTGAACTG Chr17:13983287..13983306 60.28 55
upstream ENSMUSE00000433604 Chr17:13983441..13983646 TGCCGGTATGTATTGTCCAG Chr17:13983533..13983552 59.42 50
upstream ENSMUSE00000433599 Chr17:13986115..13986260 CAGGACCGAGACCTTAGTCG Chr17:13986187..13986206 59.86 60
upstream ENSMUSE00000433594 Chr17:13986575..13986669 CTACATGCCAGCCTTTCTGG Chr17:13986611..13986630 60.79 55
upstream ENSMUSE00000433589 Chr17:13987787..13988052 ATATTGAAGCGTGGGCAGAG Chr17:13987982..13988001 60.24 50
upstream ENSMUSE00000433583 Chr17:13989323..13989466 CCCGATGAGCCTTTTATTCC Chr17:13989443..13989462 60.76 50

*** Putative Vector Insertion (Chr 17: 13989467 - 13990926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703720 Chr17:13990927..13990941 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCGATGAGCCTTTTATTCC Chr17:13989444..13989464 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAGCGTGACTGGGAAAAC Chr17:13989513..13989533 61.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068036