Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22411
Trapped Gene
Tbc1d2b (ENSMUSG00000037410)
Vector Insertion
Chr 9: 90100061 - 90102610
Public Clones not available
Private Clones OST297811 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241595 (Chr9:90102611..90102732 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCGGACTATCCTCGATGC Chr9:90102614..90102633 59.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241595 (Chr9:90102611..90102732 -)
Downstram Exon
ENSMUSE00000390700 (Chr9:90096889..90100060 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCGGACTATCCTCGATGC Chr9:90102614..90102633 59.27 55 TCAGATCCCCAAAGGAGATG Chr9:90100007..90100026 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416773 Chr9:90165190..90165607 CGCCGCTGCTACCTCTACTA Chr9:90165344..90165363 60.69 60
upstream ENSMUSE00000416747 Chr9:90144629..90144782 TGTGGCCAGAGATACCACAG Chr9:90144629..90144648 59.7 55
upstream ENSMUSE00000416737 Chr9:90135848..90136016 CATCCGAATCCCATCAACTT Chr9:90135881..90135900 59.75 45
upstream ENSMUSE00000416732 Chr9:90123776..90123939 GCAGGACCGTGTTTTACACC Chr9:90123873..90123892 60.42 55
upstream ENSMUSE00000416729 Chr9:90122168..90122412 TGGACGGAACCCTTACAAAG Chr9:90122362..90122381 59.96 50
upstream ENSMUSE00000416724 Chr9:90120859..90121242 GTATTTCACGAACCCCCAGA Chr9:90121173..90121192 59.79 50
upstream ENSMUSE00000416721 Chr9:90118277..90118387 TCGGCTCTACGAAGAAATGC Chr9:90118308..90118327 60.49 50
upstream ENSMUSE00000416719 Chr9:90117145..90117338 GGAGCAAGCATTCGTTAAGC Chr9:90117158..90117177 59.99 50
upstream ENSMUSE00000416715 Chr9:90113498..90113992 GACCGTCACACCAGGAAGTT Chr9:90113720..90113739 60.01 55
upstream ENSMUSE00000416711 Chr9:90110316..90110433 TGTCTCGTTACCATCGTGGA Chr9:90110365..90110384 60.11 50
upstream ENSMUSE00000357765 Chr9:90104506..90104691 GACTGCACACCCATTTTGAA Chr9:90104626..90104645 59.55 45
upstream ENSMUSE00000241595 Chr9:90102611..90102732 ACTCGGACTATCCTCGATGC Chr9:90102614..90102633 59.27 55

*** Putative Vector Insertion (Chr 9: 90100061 - 90102610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390700 Chr9:90096889..90100060 TCAGATCCCCAAAGGAGATG Chr9:90100007..90100026 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTATCCTCGATGCCAGGTG Chr9:90102606..90102626 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTATCCTCGATGCCAGGTG Chr9:90102606..90102626 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037410