Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22412
Trapped Gene
Rpp14 (ENSMUSG00000023156)
Vector Insertion
Chr 14: 8913027 - 8916221
Public Clones (sanger) (sanger) D146A10 (ggtc) D148A10 (ggtc) D146A10 (ggtc)
D148H12 (ggtc) IST14910H2 (tigm) IST14356D2 (tigm) IST10068G3 (tigm)
IST10931E11 (tigm)
Private Clones OST297798 (lexicon) OST185541 (lexicon) OST119509 (lexicon) OST68223 (lexicon)
OST33766 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306272 (Chr14:8912881..8913026 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGATCCTCTCCGTCCTG Chr14:8912978..8912997 60.82 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306272 (Chr14:8912881..8913026 +)
Downstram Exon
ENSMUSE00000306266 (Chr14:8916222..8916308 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGATCCTCTCCGTCCTG Chr14:8912978..8912997 60.82 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000306272 Chr14:8912881..8913026 CAGTGATCCTCTCCGTCCTG Chr14:8912978..8912997 60.82 60

*** Putative Vector Insertion (Chr 14: 8913027 - 8916221) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306266 Chr14:8916222..8916308 No primer for this exon
downstream ENSMUSE00000306256 Chr14:8916431..8916515 GTTCAGTCCAACCCCATGTT Chr14:8916464..8916483 59.68 50
downstream ENSMUSE00000133739 Chr14:8919978..8920054 ATGGCCGACAGTGTCTTCTC Chr14:8920039..8920058 60.27 55
downstream ENSMUSE00000133736 Chr14:8921233..8921311 AGGCTCCAAACAAGGTCAAA Chr14:8921279..8921298 59.71 45
downstream ENSMUSE00000394747 Chr14:8922422..8924350 AGCTTCCGGGACCATAACTT Chr14:8923059..8923078 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCTACTAATCGCCTTGCAG Chr14:8913071..8913092 60.18 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTACCGTGACTGGGAAA Chr14:8913071..8913091 61.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023156