Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22416
Trapped Gene
A930041I02Rik (ENSMUSG00000035236)
Vector Insertion
Chr 2: 38963924 - 38976630
Public Clones not available
Private Clones OST297670 (lexicon) OST234310 (lexicon) OST201447 (lexicon) OST41460 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645514 (Chr2:38976631..38976729 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645514 (Chr2:38976631..38976729 -)
Downstram Exon
ENSMUSE00000645512 (Chr2:38963827..38963923 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGGTCTTTCACAACGTCCA Chr2:38963811..38963830 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487423 Chr2:39046110..39046250 No primer for this exon
upstream ENSMUSE00000567343 Chr2:39045509..39045553 CTGTCTGGCACAGTGGAGAA Chr2:39045533..39045552 60.02 55
upstream ENSMUSE00000567341 Chr2:38988475..38988606 ATGACATCCCACAGGGAGAG Chr2:38988540..38988559 59.92 55
upstream ENSMUSE00000645517 Chr2:38980610..38980705 GCAGTGGCAGTCCTACTTCG Chr2:38980662..38980681 61 60
upstream ENSMUSE00000645515 Chr2:38978524..38978610 CAAGATCGGGCAGCTGTATT Chr2:38978534..38978553 60.24 50
upstream ENSMUSE00000645514 Chr2:38976631..38976729 No primer for this exon

*** Putative Vector Insertion (Chr 2: 38963924 - 38976630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645512 Chr2:38963827..38963923 CAGGTCTTTCACAACGTCCA Chr2:38963811..38963830 59.72 50
downstream ENSMUSE00000645511 Chr2:38962728..38962826 CACCAGGTTCCACTCGACTT Chr2:38962733..38962752 60.15 55
downstream ENSMUSE00000645510 Chr2:38962440..38962592 CAACTGTCCCACAATCATGC Chr2:38962460..38962479 59.97 50
downstream ENSMUSE00000645509 Chr2:38959184..38959285 CATCCGGAACATGTCAACAG Chr2:38959225..38959244 59.96 50
downstream ENSMUSE00000645508 Chr2:38958723..38958824 GTTGGCTGAAAGTCGGTTTG Chr2:38958730..38958749 60.67 50
downstream ENSMUSE00000645507 Chr2:38957841..38957919 ACACTATTGGCAGGCAGCTC Chr2:38957878..38957897 60.43 55
downstream ENSMUSE00000645506 Chr2:38954896..38954995 TGATTTCGCTTGTGGATAGC Chr2:38954895..38954914 58.87 45
downstream ENSMUSE00000645505 Chr2:38950223..38950304 GAACAGGGGTTTCCTTGTGA Chr2:38950237..38950256 59.94 50
downstream ENSMUSE00000645504 Chr2:38939058..38939130 AGACGAGTGGCTGTCCAAAC Chr2:38939075..38939094 60.31 55
downstream ENSMUSE00000645503 Chr2:38935894..38936067 AGGCTACCTCGCTGAGACTG Chr2:38936024..38936043 59.77 60
downstream ENSMUSE00000567348 Chr2:38935597..38935697 AAACTGGAGGAAGGCCTGAT Chr2:38935656..38935675 60.07 50
downstream ENSMUSE00000645502 Chr2:38921734..38930676 GTTTTTGAGAGCACCGCTTC Chr2:38927133..38927152 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCCTGCACTTCCAGTAA Chr2:38976576..38976596 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTTCTTTGCACAGCGTGA Chr2:38976574..38976594 60.46 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035236