Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22422
Trapped Gene
D9Ertd402e (ENSMUSG00000046603)
Vector Insertion
Chr 9: 122717955 - 122720875
Public Clones not available
Private Clones OST297475 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371934 (Chr9:122717885..122717954 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTGCTTATTCGGAAATGT Chr9:122717910..122717929 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371934 (Chr9:122717885..122717954 +)
Downstram Exon
ENSMUSE00000336815 (Chr9:122720876..122721011 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTGCTTATTCGGAAATGT Chr9:122717910..122717929 60.1 45 TTCTGCCCCTGATAAAGCTC Chr9:122720942..122720961 59.41 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582935 Chr9:122714716..122714806 GAAGAACCGGCTTGTGTCTC Chr9:122714753..122714772 59.85 55
upstream ENSMUSE00000371934 Chr9:122717885..122717954 GCGTGCTTATTCGGAAATGT Chr9:122717910..122717929 60.1 45

*** Putative Vector Insertion (Chr 9: 122717955 - 122720875) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336815 Chr9:122720876..122721011 TTCTGCCCCTGATAAAGCTC Chr9:122720942..122720961 59.41 50
downstream ENSMUSE00000380287 Chr9:122723550..122723706 TGGCCTTCAGAGGAATTCTG Chr9:122723689..122723708 60.33 50
downstream ENSMUSE00000408185 Chr9:122727892..122728144 GGCTGGGAATGCACATTAGT Chr9:122728021..122728040 59.96 50
downstream ENSMUSE00000370338 Chr9:122733581..122733703 CTGAAAGCTGCAGAAGCTCA Chr9:122733699..122733718 59.62 50
downstream ENSMUSE00000334891 Chr9:122735311..122735408 No primer for this exon
downstream ENSMUSE00000377638 Chr9:122735965..122736056 ATGGCCCAGTGCACTCATAC Chr9:122736017..122736036 60.96 55
downstream ENSMUSE00000364187 Chr9:122740738..122740976 AACCACTTGGATTCCCCCTA Chr9:122740836..122740855 60.55 50
downstream ENSMUSE00000405034 Chr9:122742644..122742775 AGGCTTGCTGGATCTGAGAG Chr9:122742718..122742737 59.7 55
downstream ENSMUSE00000406122 Chr9:122743854..122745447 TATGGCAGCGACTGTTCAAG Chr9:122743994..122744013 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTTGAGGCCTTTGAGGAG Chr9:122717936..122717956 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTTGAGGCCTTTGAGGAG Chr9:122717936..122717956 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046603