Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22426
Trapped Gene
Ltbp4 (ENSMUSG00000040488)
Vector Insertion
Chr 7: 28115338 - 28118373
Public Clones (sanger) E110D07 (ggtc) E099C04 (ggtc) (ggtc) E031G08 (ggtc)
IST14873G8 (tigm) IST13200E10 (tigm) IST13250E4 (tigm) IST11863E1 (tigm)
IST13504F9 (tigm) IST14808E3 (tigm) IST12556E8 (tigm) IST13663C12 (tigm)
IST13962A9 (tigm) IST13290E10 (tigm) IST12069C9 (tigm) IST13413H12 (tigm)
IST15031F3 (tigm) IST13334E1 (tigm) IST13319F2 (tigm) IST11772H4 (tigm)
IST13253E2 (tigm) IST13309H1 (tigm) IST14559G11 (tigm) IST11937D11 (tigm)
IST14559G11 (tigm) IST14654F9 (tigm) IST12069C9 (tigm) IST13413A1 (tigm)
IST13266E9 (tigm)
Private Clones OST297364 (lexicon) OST188225 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676486 (Chr7:28118374..28118428 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676486 (Chr7:28118374..28118428 -)
Downstram Exon
ENSMUSE00000307052 (Chr7:28115146..28115337 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCACCGTTGTGACAGATCA Chr7:28115284..28115303 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501397 Chr7:28122447..28122711 AGAAAGTGAGTCGGCCTCTG Chr7:28122681..28122700 59.6 55
upstream ENSMUSE00000676489 Chr7:28120696..28120730 TGTCACTGCTGCCTAGACCA Chr7:28120701..28120720 60.62 55
upstream ENSMUSE00000488113 Chr7:28120672..28120730 GCTGCCTAGACCAGACACCT Chr7:28120694..28120713 59.48 60
upstream ENSMUSE00000490043 Chr7:28120416..28120554 CAGTCCCGTGGAGAAGAGTC Chr7:28120444..28120463 59.83 60
upstream ENSMUSE00000484703 Chr7:28119856..28119965 GAAAAGAAGGCCCCCACATC Chr7:28119880..28119899 62.97 55
upstream ENSMUSE00000676487 Chr7:28118431..28118648 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000676486 Chr7:28118374..28118428 No primer for this exon
upstream ENSMUSE00000708828 Chr7:28118374..28118667 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000709573 Chr7:28118374..28118632 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000716944 Chr7:28118374..28118682 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55

*** Putative Vector Insertion (Chr 7: 28115338 - 28118373) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307052 Chr7:28115146..28115337 ACCACCGTTGTGACAGATCA Chr7:28115284..28115303 60.01 50
downstream ENSMUSE00000535658 Chr7:28114590..28114837 CTTCCGCGCAGTTCTCTAAA Chr7:28114572..28114591 60.65 50
downstream ENSMUSE00000535657 Chr7:28114398..28114500 CACGGGTGACAATCATGAAC Chr7:28114390..28114409 59.81 50
downstream ENSMUSE00000535656 Chr7:28113987..28114061 GCCACTCACTTGGTTGGAGT Chr7:28114017..28114036 60.16 55
downstream ENSMUSE00000535654 Chr7:28113759..28113881 GAAACCGTCCGGACATACAC Chr7:28113768..28113787 60.24 55
downstream ENSMUSE00000535653 Chr7:28113205..28113369 CATCATGCAGCACTCGGTAG Chr7:28113294..28113313 60.44 55
downstream ENSMUSE00000407351 Chr7:28112657..28112806 TGGTGTTGTATCGGAGGTCA Chr7:28112713..28112732 59.96 50
downstream ENSMUSE00000362610 Chr7:28112280..28112531 GGTCGACGAGTAGGCAGAAA Chr7:28112488..28112507 60.4 55
downstream ENSMUSE00000307165 Chr7:28111711..28111842 No primer for this exon
downstream ENSMUSE00000307108 Chr7:28111506..28111631 GCCTGGTGTATTCTCGCAAC Chr7:28111545..28111564 60.67 55
downstream ENSMUSE00000307161 Chr7:28110697..28110822 CGGGACACACACATAGGAAA Chr7:28110714..28110733 59.42 50
downstream ENSMUSE00000307156 Chr7:28110038..28110280 No primer for this exon
downstream ENSMUSE00000307950 Chr7:28109313..28109438 GTTGGGCAGACACACTTGAA Chr7:28109329..28109348 59.73 50
downstream ENSMUSE00000308043 Chr7:28109106..28109225 AGCGGTTCTCACACTCATCC Chr7:28109180..28109199 60.27 55
downstream ENSMUSE00000308034 Chr7:28108161..28108289 No primer for this exon
downstream ENSMUSE00000308025 Chr7:28107830..28107955 GACAAGATGCTCCACGAGGT Chr7:28107811..28107830 60.27 55
downstream ENSMUSE00000308018 Chr7:28107308..28107430 AGATCCTCTTCGCTGCACTC Chr7:28107381..28107400 59.71 55
downstream ENSMUSE00000308012 Chr7:28107041..28107172 TGGTAACCTGGATCGCAGTC Chr7:28107045..28107064 61.07 55
downstream ENSMUSE00000307031 Chr7:28104644..28104775 ACAAATCGCAGAGCCGTATT Chr7:28104716..28104735 59.74 45
downstream ENSMUSE00000307152 Chr7:28104430..28104555 GCAGATTCTGGCACATAGCA Chr7:28104474..28104493 59.98 50
downstream ENSMUSE00000535649 Chr7:28099256..28099402 CACACGCCCTGTAGTGTCTC Chr7:28099347..28099366 59.34 60
downstream ENSMUSE00000711483 Chr7:28096579..28096831 GAATAGGGGCACGTGTGTAAA Chr7:28096615..28096635 59.88 47.62
downstream ENSMUSE00000535648 Chr7:28095540..28095806 ATTGTCACACGCATCTGGAG Chr7:28095618..28095637 59.71 50
downstream ENSMUSE00000535647 Chr7:28095200..28095271 CCGTGAGGACACAATGACTG Chr7:28095222..28095241 60.15 55
downstream ENSMUSE00000535645 Chr7:28094305..28094433 AAGAGTTGGCATTCGTCCAC Chr7:28094390..28094409 60.12 50
downstream ENSMUSE00000535644 Chr7:28093940..28094086 GCTCGCAGGTACAGTGGTAAG Chr7:28093978..28093998 59.95 57.14
downstream ENSMUSE00000307972 Chr7:28092787..28092939 AGACAGCAGCACTCGGTGTA Chr7:28092818..28092837 59.65 55
downstream ENSMUSE00000307021 Chr7:28091581..28091961 AGGGGTCGTAGGGTAGCACT Chr7:28091772..28091791 60.02 60
downstream ENSMUSE00000307074 Chr7:28091086..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000719934 Chr7:28091017..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000465029 Chr7:28090161..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50
downstream ENSMUSE00000709638 Chr7:28090159..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCGTTTCAGTGCTGGGTA Chr7:28115395..28115415 61.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTCTCAGCGTGACTGG Chr7:28115327..28115347 59.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTACCTTGAGGCCCTCGTTT Chr7:28115407..28115427 60.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTACCTTGAGGCCCTCGTTT Chr7:28115407..28115427 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040488