Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22429
Trapped Gene
Hormad1 (ENSMUSG00000028109)
Vector Insertion
Chr 3: 95389512 - 95391302
Public Clones not available
Private Clones OST297238 (lexicon) OST2357 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000566220 (Chr3:95389457..95389511 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACAAGATGCCCTGGACT Chr3:95389481..95389500 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000566220 (Chr3:95389457..95389511 +)
Downstram Exon
ENSMUSE00000588559 (Chr3:95391303..95391517 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACAAGATGCCCTGGACT Chr3:95389481..95389500 60.11 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000252075 Chr3:95363599..95363645 No primer for this exon
upstream ENSMUSE00000672252 Chr3:95363600..95363654 No primer for this exon
upstream ENSMUSE00000402116 Chr3:95365150..95365202 GGAAGATGGCCACTATGCAG Chr3:95365162..95365181 60.62 55
upstream ENSMUSE00000708265 Chr3:95365150..95365202 GGAAGATGGCCACTATGCAG Chr3:95365162..95365181 60.62 55
upstream ENSMUSE00000176269 Chr3:95366402..95366546 CAGAACGTGCTTATGGGACA Chr3:95366514..95366533 59.72 50
upstream ENSMUSE00000176262 Chr3:95370543..95370606 ATTGTCCAGGTTCTTCACAGC Chr3:95370576..95370596 59.2 47.62
upstream ENSMUSE00000176266 Chr3:95371606..95371642 TGCTTGGATGCTATGATGCT Chr3:95371608..95371627 59.4 45
upstream ENSMUSE00000672251 Chr3:95374588..95374608 No primer for this exon
upstream ENSMUSE00000176267 Chr3:95374850..95374876 ACCAATCCAGGAGATCCTCA Chr3:95374856..95374875 59.46 50
upstream ENSMUSE00000176265 Chr3:95379457..95379524 CACCAAAAATGGACCAATCA Chr3:95379492..95379511 59.22 40
upstream ENSMUSE00000176260 Chr3:95380199..95380350 CTGCTGACACCAAGAAAGCA Chr3:95380231..95380250 60.17 50
upstream ENSMUSE00000176259 Chr3:95381975..95382222 CCCAGATTACCAACCACCAG Chr3:95381982..95382001 60.22 55
upstream ENSMUSE00000176264 Chr3:95383927..95383993 No primer for this exon
upstream ENSMUSE00000176268 Chr3:95384080..95384156 No primer for this exon
upstream ENSMUSE00000252010 Chr3:95385429..95385512 AGCAAAACAAGAAGCGGAAA Chr3:95385474..95385493 60 40
upstream ENSMUSE00000333139 Chr3:95389062..95389136 CGGAAGAGAAGTCTTCGTCAA Chr3:95389104..95389124 59.6 47.62
upstream ENSMUSE00000566220 Chr3:95389457..95389511 CAAACAAGATGCCCTGGACT Chr3:95389481..95389500 60.11 50

*** Putative Vector Insertion (Chr 3: 95389512 - 95391302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000588559 Chr3:95391303..95391517 No primer for this exon
downstream ENSMUSE00000588560 Chr3:95391303..95391593 No primer for this exon
downstream ENSMUSE00000672244 Chr3:95391303..95391518 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACCTGAGTGTAGGTGACAAAC Chr3:95389464..95389487 61.01 52.17 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGAGTGTAGGTGACAAACAA Chr3:95389466..95389489 58.69 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028109