Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22432
Trapped Gene
5730596K20Rik (ENSMUSG00000024759)
Vector Insertion
Chr 19: 7605082 - 7606505
Public Clones not available
Private Clones OST297182 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144780 (Chr19:7605010..7605081 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCACTGCTGAAGCCAATAA Chr19:7605010..7605029 61.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144780 (Chr19:7605010..7605081 +)
Downstram Exon
ENSMUSE00000144781 (Chr19:7606506..7606937 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCACTGCTGAAGCCAATAA Chr19:7605010..7605029 61.3 50 ACTGCCCGGAATATCTGATG Chr19:7606887..7606906 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643443 Chr19:7568971..7569151 AACCCGCTCCTGTCTTCTCT Chr19:7569053..7569072 60.39 55
upstream ENSMUSE00000144777 Chr19:7583838..7584052 GGTCCAGTGCAGGTTGTTTT Chr19:7583864..7583883 60.01 50
upstream ENSMUSE00000238419 Chr19:7584473..7584616 CATTCAGACTGGTTGGGTGA Chr19:7584485..7584504 59.52 50
upstream ENSMUSE00000550582 Chr19:7591368..7591472 CAGCCAGTCAACTGTGAAGG Chr19:7591406..7591425 59.46 55
upstream ENSMUSE00000144779 Chr19:7593036..7593086 No primer for this exon
upstream ENSMUSE00000144785 Chr19:7595277..7595333 GCAATGGATGAAATTTTCCAA Chr19:7595301..7595321 59.76 33.33
upstream ENSMUSE00000144784 Chr19:7595600..7595692 ATGGACTGCAAGGAGGAATG Chr19:7595649..7595668 60.07 50
upstream ENSMUSE00000144788 Chr19:7596559..7596697 TGTTTCTCCGATGTCACCTG Chr19:7596613..7596632 59.68 50
upstream ENSMUSE00000144783 Chr19:7603432..7603559 TCAATGGTTCAAAAGTCACCTG Chr19:7603513..7603534 60.01 40.91
upstream ENSMUSE00000144787 Chr19:7604098..7604154 No primer for this exon
upstream ENSMUSE00000144780 Chr19:7605010..7605081 GCCACTGCTGAAGCCAATAA Chr19:7605010..7605029 61.3 50

*** Putative Vector Insertion (Chr 19: 7605082 - 7606505) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144781 Chr19:7606506..7606937 ACTGCCCGGAATATCTGATG Chr19:7606887..7606906 59.92 50
downstream ENSMUSE00000643432 Chr19:7608440..7611090 CAACAACGGCATCCCTTACT Chr19:7608497..7608516 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr19:7605132..7605152 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGTGTCATTTTCCCAGCA Chr19:7605106..7605126 58.7 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024759