Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22437
Trapped Gene
Tfpi (ENSMUSG00000027082)
Vector Insertion
Chr 2: 84316897 - 84316921
Public Clones not available
Private Clones OST297028 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688739 (Chr2:84316898..84316932 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688739 (Chr2:84316898..84316932 -)
Downstram Exon
ENSMUSE00000688747 (Chr2:84316848..84316920 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCACAGCGAGGAAGGACTTT Chr2:84316847..84316866 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688739 Chr2:84316898..84316932 No primer for this exon

*** Putative Vector Insertion (Chr 2: 84316897 - 84316921) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688736 Chr2:84316848..84316905 TCACAGCGAGGAAGGACTTT Chr2:84316847..84316866 59.99 50
downstream ENSMUSE00000688747 Chr2:84316848..84316920 TCACAGCGAGGAAGGACTTT Chr2:84316847..84316866 59.99 50
downstream ENSMUSE00000688756 Chr2:84314919..84315437 GACAGGCAAGCTCACAGACA Chr2:84315018..84315037 60.19 55
downstream ENSMUSE00000415207 Chr2:84314100..84314192 TGTAAAGGTTGCTCGGGAAG Chr2:84314107..84314126 60.24 50
downstream ENSMUSE00000688753 Chr2:84314100..84314342 CGTCAGACACACGGAGAAAA Chr2:84314079..84314098 59.87 50
downstream ENSMUSE00000237244 Chr2:84313856..84313956 GAGACAGGTCCCGAAAGTGA Chr2:84313909..84313928 60.24 55
downstream ENSMUSE00000600985 Chr2:84313856..84313941 CTGGAGATGAGGTCCCAAAA Chr2:84313864..84313883 60.04 50
downstream ENSMUSE00000237237 Chr2:84298180..84298290 GAAACTCGGGAACAAGGCTA Chr2:84298191..84298210 59.31 50
downstream ENSMUSE00000712250 Chr2:84298180..84298290 GAAACTCGGGAACAAGGCTA Chr2:84298191..84298210 59.31 50
downstream ENSMUSE00000165893 Chr2:84293957..84294154 TTCTCGTTCCCTTCACATCC Chr2:84293979..84293998 60.05 50
downstream ENSMUSE00000165888 Chr2:84292714..84292752 GCTGCCTTCACAGCTGTCTT Chr2:84292703..84292722 60.74 55
downstream ENSMUSE00000237215 Chr2:84284897..84285073 CACGAATCGTTCACACTGCT Chr2:84284948..84284967 59.9 50
downstream ENSMUSE00000165889 Chr2:84284167..84284295 TGGGGAACCACGATGTTATT Chr2:84284171..84284190 60.05 45
downstream ENSMUSE00000688761 Chr2:84284167..84284277 TGGGGAACCACGATGTTATT Chr2:84284171..84284190 60.05 45
downstream ENSMUSE00000688738 Chr2:84283360..84283469 ACGGAACTCAGAAAGCCTTG Chr2:84283378..84283397 59.47 50
downstream ENSMUSE00000688748 Chr2:84283027..84283082 No primer for this exon
downstream ENSMUSE00000565912 Chr2:84280297..84283082 AACCCATCGGTGATGACATT Chr2:84282676..84282695 60.06 45
downstream ENSMUSE00000688735 Chr2:84280297..84283469 AACCCATCGGTGATGACATT Chr2:84282676..84282695 60.06 45
downstream ENSMUSE00000165890 Chr2:84274399..84274578 TCCCCCACATCCAGTGTAGT Chr2:84274429..84274448 60.24 55
downstream ENSMUSE00000377228 Chr2:84273014..84273341 TGGTCACCAATGGAAACAAG Chr2:84273114..84273133 59.39 45
downstream ENSMUSE00000688760 Chr2:84273012..84273341 TGGTCACCAATGGAAACAAG Chr2:84273114..84273133 59.39 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000027082