Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22438
Trapped Gene
Fbxo6 (ENSMUSG00000055401)
Vector Insertion
Chr 4: 147521531 - 147523487
Public Clones not available
Private Clones OST297014 (lexicon) OST248976 (lexicon) OST208939 (lexicon) OST184496 (lexicon)
OST72864 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184381 (Chr4:147523488..147523775 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTATGGAAGCGCAAGAGTC Chr4:147523599..147523618 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184381 (Chr4:147523488..147523775 -)
Downstram Exon
ENSMUSE00000184372 (Chr4:147521404..147521530 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTATGGAAGCGCAAGAGTC Chr4:147523599..147523618 59.98 55 ATCCCCTCCGTTGGAGTCTA Chr4:147521468..147521487 60.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447489 Chr4:147526051..147526168 GCTCCGAGCTCACCATCTTC Chr4:147526078..147526097 62.41 60
upstream ENSMUSE00000630305 Chr4:147525723..147526001 No primer for this exon
upstream ENSMUSE00000667225 Chr4:147525197..147526017 CCGTGTAGGCAGCTTTTAGG Chr4:147525522..147525541 59.9 55
upstream ENSMUSE00000184381 Chr4:147523488..147523775 CCTATGGAAGCGCAAGAGTC Chr4:147523599..147523618 59.98 55
upstream ENSMUSE00000717444 Chr4:147523488..147523775 CCTATGGAAGCGCAAGAGTC Chr4:147523599..147523618 59.98 55

*** Putative Vector Insertion (Chr 4: 147521531 - 147523487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184372 Chr4:147521404..147521530 ATCCCCTCCGTTGGAGTCTA Chr4:147521468..147521487 60.84 55
downstream ENSMUSE00000184375 Chr4:147520949..147521044 No primer for this exon
downstream ENSMUSE00000184362 Chr4:147520430..147520565 CAGCTGTACCCGGAGTTGAT Chr4:147520492..147520511 60.13 55
downstream ENSMUSE00000447503 Chr4:147519897..147520294 GAGCCTGACTGCCCACTAAC Chr4:147519988..147520007 59.87 60
downstream ENSMUSE00000630300 Chr4:147519825..147520294 GAGCCTGACTGCCCACTAAC Chr4:147519988..147520007 59.87 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACCTAATCGCCTTGCAG Chr4:147523422..147523442 61.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTTCCCTGAACCCGTGAC Chr4:147523430..147523450 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055401